Incidental Mutation 'R6605:Trdv2-1'
List |< first << previous [record 36 of 40] next >> last >|
ID525631
Institutional Source Beutler Lab
Gene Symbol Trdv2-1
Ensembl Gene ENSMUSG00000076865
Gene NameT cell receptor delta variable 2-1
SynonymsENSMUSG00000068352
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location53946073-53946660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53946542 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 77 (N77S)
Ref Sequence ENSEMBL: ENSMUSP00000143506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103677] [ENSMUST00000197130]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103677
AA Change: N76S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100454
Gene: ENSMUSG00000076865
AA Change: N76S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 37 112 6.65e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197130
AA Change: N77S

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143506
Gene: ENSMUSG00000076865
AA Change: N77S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 113 2.8e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198142
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Trdv2-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Trdv2-1 APN 14 53946611 missense probably benign 0.01
R3718:Trdv2-1 UTSW 14 53946538 missense probably benign
R5213:Trdv2-1 UTSW 14 53946406 missense probably benign 0.42
R6265:Trdv2-1 UTSW 14 53946385 missense probably benign 0.01
R7423:Trdv2-1 UTSW 14 53946478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAGACAGTGTCTCAG -3'
(R):5'- GCTGGAGGAGAGTAGCATTTAC -3'

Sequencing Primer
(F):5'- GACAGTGTCTCAGCCTCAGAAG -3'
(R):5'- GCATTTACTCCGAAGAAAAGTTGATG -3'
Posted On2018-06-22