Incidental Mutation 'R6639:Olfr354'
ID525632
Institutional Source Beutler Lab
Gene Symbol Olfr354
Ensembl Gene ENSMUSG00000055088
Gene Nameolfactory receptor 354
SynonymsGA_x6K02T2NLDC-33601476-33602429, MOR127-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R6639 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36905680-36916038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36907678 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 244 (C244Y)
Ref Sequence ENSEMBL: ENSMUSP00000149298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068475] [ENSMUST00000217479]
Predicted Effect probably damaging
Transcript: ENSMUST00000068475
AA Change: C244Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068986
Gene: ENSMUSG00000055088
AA Change: C244Y

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 2.1e-62 PFAM
Pfam:7tm_1 44 293 2.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121665
Predicted Effect probably damaging
Transcript: ENSMUST00000217479
AA Change: C244Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218102
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,530 S226P probably benign Het
Adgb T G 10: 10,435,956 I238L possibly damaging Het
Ankrd33b T C 15: 31,297,672 Y313C probably damaging Het
Capn15 C T 17: 25,960,178 V940I probably benign Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Cfap57 T C 4: 118,554,712 E1245G probably benign Het
Depdc7 C T 2: 104,724,753 D271N probably damaging Het
Dmtn T C 14: 70,617,430 D10G probably damaging Het
Dusp12 T C 1: 170,880,674 E158G probably damaging Het
Egf C T 3: 129,736,832 G227D probably benign Het
Epha1 C A 6: 42,365,935 E227* probably null Het
Fbxo40 A T 16: 36,970,575 C58S probably damaging Het
Focad A G 4: 88,278,242 T611A unknown Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fsip2 G A 2: 82,983,227 D3297N possibly damaging Het
Garnl3 T C 2: 32,989,525 R930G possibly damaging Het
Hdac4 A T 1: 91,970,948 C695S probably damaging Het
Ier2 G A 8: 84,662,162 T197M probably benign Het
Ift74 T A 4: 94,664,259 probably benign Het
Kat6b A G 14: 21,517,494 D207G possibly damaging Het
Khdrbs2 A T 1: 32,467,862 R196* probably null Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Nrip1 G A 16: 76,293,995 Q225* probably null Het
Olfr114 A G 17: 37,589,931 C141R probably damaging Het
Pdrg1 T C 2: 153,015,271 E17G probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rnf17 C T 14: 56,438,743 P354S probably benign Het
Sh3rf3 T A 10: 59,083,467 Y469N probably damaging Het
Thoc6 T A 17: 23,670,454 probably null Het
Tpm3 C G 3: 90,079,802 A24G probably damaging Het
Tuft1 T C 3: 94,632,623 M93V probably benign Het
Vmn1r22 T C 6: 57,900,714 I93V probably benign Het
Zfp383 T C 7: 29,914,727 S136P probably benign Het
Zfp748 T C 13: 67,542,905 K79E probably damaging Het
Other mutations in Olfr354
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Olfr354 APN 2 36907857 missense probably benign
IGL02573:Olfr354 APN 2 36907554 missense probably damaging 1.00
P0027:Olfr354 UTSW 2 36907570 missense probably benign 0.00
R0040:Olfr354 UTSW 2 36907458 missense probably damaging 1.00
R0610:Olfr354 UTSW 2 36907659 missense probably damaging 1.00
R0760:Olfr354 UTSW 2 36907221 missense probably benign 0.25
R1727:Olfr354 UTSW 2 36907393 missense probably benign 0.00
R2972:Olfr354 UTSW 2 36907404 missense probably benign 0.03
R4671:Olfr354 UTSW 2 36907393 missense probably benign 0.00
R4750:Olfr354 UTSW 2 36907716 missense probably benign 0.13
R5043:Olfr354 UTSW 2 36906965 missense probably benign 0.01
R5400:Olfr354 UTSW 2 36907821 missense probably damaging 1.00
R5543:Olfr354 UTSW 2 36907357 missense possibly damaging 0.75
R5792:Olfr354 UTSW 2 36907101 missense probably benign 0.00
R6876:Olfr354 UTSW 2 36907822 missense probably damaging 1.00
T0722:Olfr354 UTSW 2 36907570 missense probably benign 0.00
Z1176:Olfr354 UTSW 2 36907701 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGCTCTGCTGAAACTTGCC -3'
(R):5'- CACATCACAACCTGGAGGAG -3'

Sequencing Primer
(F):5'- CTGTTCTGACACCCACATTAATGAG -3'
(R):5'- GAATCACTGGAGAATCACAGTTTG -3'
Posted On2018-06-22