Incidental Mutation 'R6605:Mief1'
List [record 1 of 40] next >> last >|
ID525635
Institutional Source Beutler Lab
Gene Symbol Mief1
Ensembl Gene ENSMUSG00000022412
Gene Namemitochondrial elongation factor 1
SynonymsSmcr7l
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location80234018-80253371 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80248491 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 191 (Y191*)
Ref Sequence ENSEMBL: ENSMUSP00000154875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023048] [ENSMUST00000166030] [ENSMUST00000228788] [ENSMUST00000229138]
Predicted Effect probably null
Transcript: ENSMUST00000023048
AA Change: Y191*
SMART Domains Protein: ENSMUSP00000023048
Gene: ENSMUSG00000022412
AA Change: Y191*

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Mab-21 189 455 7.09e-84 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166030
AA Change: Y191*
SMART Domains Protein: ENSMUSP00000129209
Gene: ENSMUSG00000022412
AA Change: Y191*

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Mab-21 189 455 7.09e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000228788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228965
Predicted Effect probably null
Transcript: ENSMUST00000229138
AA Change: Y191*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Mief1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Mief1 APN 15 80248508 splice site probably benign
R1754:Mief1 UTSW 15 80249602 missense probably damaging 0.97
R2010:Mief1 UTSW 15 80247925 missense possibly damaging 0.95
R4379:Mief1 UTSW 15 80247959 missense possibly damaging 0.86
R4609:Mief1 UTSW 15 80248253 missense probably benign 0.12
R4789:Mief1 UTSW 15 80247879 nonsense probably null
R5862:Mief1 UTSW 15 80248385 missense probably benign 0.01
R6101:Mief1 UTSW 15 80249740 missense probably benign 0.00
R6350:Mief1 UTSW 15 80249603 missense probably damaging 1.00
R6944:Mief1 UTSW 15 80249443 missense probably damaging 1.00
R7197:Mief1 UTSW 15 80249860 missense possibly damaging 0.94
R7316:Mief1 UTSW 15 80249397 missense probably damaging 0.99
R7905:Mief1 UTSW 15 80249398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCACGACTCCGCATGTC -3'
(R):5'- GGTTTCTTAGAGCTACCCTGG -3'

Sequencing Primer
(F):5'- CCCTGCAGGAGAAACTTCTTTC -3'
(R):5'- GGTGCTGGCCTCAAACTACATAG -3'
Posted On2018-06-22