Incidental Mutation 'R6605:Eva1c'
ID 525637
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Name eva-1 homolog C
Synonyms 4931408A02Rik, 1700092M14Rik, Fam176c
MMRRC Submission 044728-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R6605 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 90623607-90701997 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90663236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 91 (V91D)
Ref Sequence ENSEMBL: ENSMUSP00000097145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000154180] [ENSMUST00000231964] [ENSMUST00000231280]
AlphaFold P58659
Predicted Effect probably damaging
Transcript: ENSMUST00000037539
AA Change: V85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: V85D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099543
AA Change: V85D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: V85D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099548
AA Change: V91D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: V91D

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154180
SMART Domains Protein: ENSMUSP00000119830
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 2.9e-13 PFAM
Pfam:Gal_Lectin 81 145 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231964
Predicted Effect probably benign
Transcript: ENSMUST00000231280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232274
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T A 7: 45,630,481 (GRCm39) I1260F probably damaging Het
Acat2 A G 17: 13,162,774 (GRCm39) V358A probably benign Het
Adgrv1 G A 13: 81,636,081 (GRCm39) A3476V possibly damaging Het
Akap13 A G 7: 75,229,516 (GRCm39) N150D probably damaging Het
Asb2 G T 12: 103,311,943 (GRCm39) Q60K probably benign Het
Asxl3 A T 18: 22,650,134 (GRCm39) R708* probably null Het
Cd79b C T 11: 106,203,539 (GRCm39) G116D probably damaging Het
Copg2 A G 6: 30,835,757 (GRCm39) F218S probably benign Het
Defa5 A C 8: 21,787,604 (GRCm39) E50D possibly damaging Het
Efcab3 T A 11: 104,890,107 (GRCm39) probably null Het
Fosb T C 7: 19,043,283 (GRCm39) Y25C probably damaging Het
Gm5141 G A 13: 62,922,201 (GRCm39) H323Y probably damaging Het
Gpr19 T C 6: 134,847,398 (GRCm39) N58S probably benign Het
Gpr26 G A 7: 131,585,893 (GRCm39) A288T possibly damaging Het
Gucy2g T A 19: 55,229,460 (GRCm39) Q70L probably damaging Het
Ifit2 C T 19: 34,550,897 (GRCm39) R146* probably null Het
Lgr5 A C 10: 115,293,772 (GRCm39) N408K possibly damaging Het
Lrp1 G A 10: 127,396,005 (GRCm39) H2422Y probably damaging Het
Mief1 T A 15: 80,132,692 (GRCm39) Y191* probably null Het
Npr3 C G 15: 11,905,518 (GRCm39) A70P probably damaging Het
Or2y1b A T 11: 49,208,541 (GRCm39) H56L probably damaging Het
Pcnt A G 10: 76,265,032 (GRCm39) probably null Het
Pnlip A T 19: 58,660,174 (GRCm39) D29V probably benign Het
Pnpt1 T A 11: 29,088,567 (GRCm39) F277I possibly damaging Het
Pou2f2 A C 7: 24,793,006 (GRCm39) V441G probably damaging Het
Prdm4 A G 10: 85,740,002 (GRCm39) V459A probably benign Het
Ptprs A T 17: 56,729,195 (GRCm39) V855E probably damaging Het
Rflna A G 5: 125,088,352 (GRCm39) T100A probably benign Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Spata31h1 A T 10: 82,131,871 (GRCm39) S380T probably benign Het
Syn3 A G 10: 85,893,428 (GRCm39) S472P unknown Het
Taar8a A T 10: 23,952,674 (GRCm39) I93F possibly damaging Het
Taok2 T A 7: 126,477,930 (GRCm39) D207V probably damaging Het
Tpst2 A T 5: 112,424,600 (GRCm39) probably benign Homo
Trdv2-1 A G 14: 54,183,999 (GRCm39) N77S possibly damaging Het
Wdr17 A C 8: 55,134,559 (GRCm39) V18G probably benign Het
Zbtb17 T C 4: 141,192,261 (GRCm39) V402A probably damaging Het
Zfp772 T C 7: 7,208,547 (GRCm39) E99G possibly damaging Het
Zw10 A G 9: 48,980,926 (GRCm39) D442G probably benign Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90,701,235 (GRCm39) missense probably damaging 1.00
IGL02061:Eva1c APN 16 90,663,163 (GRCm39) nonsense probably null
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90,663,305 (GRCm39) missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90,672,986 (GRCm39) missense probably benign 0.03
R1330:Eva1c UTSW 16 90,701,284 (GRCm39) missense probably damaging 1.00
R1765:Eva1c UTSW 16 90,701,135 (GRCm39) missense probably benign 0.01
R1824:Eva1c UTSW 16 90,663,331 (GRCm39) missense probably benign 0.01
R1880:Eva1c UTSW 16 90,694,303 (GRCm39) missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90,628,213 (GRCm39) missense probably benign 0.12
R4072:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4076:Eva1c UTSW 16 90,701,019 (GRCm39) missense probably damaging 1.00
R4622:Eva1c UTSW 16 90,694,343 (GRCm39) critical splice donor site probably null
R4760:Eva1c UTSW 16 90,701,138 (GRCm39) missense probably benign 0.37
R4767:Eva1c UTSW 16 90,701,235 (GRCm39) missense probably damaging 1.00
R5024:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R5304:Eva1c UTSW 16 90,666,551 (GRCm39) missense probably damaging 1.00
R5559:Eva1c UTSW 16 90,701,139 (GRCm39) missense probably benign 0.06
R7222:Eva1c UTSW 16 90,701,072 (GRCm39) small deletion probably benign
R7409:Eva1c UTSW 16 90,666,544 (GRCm39) missense probably damaging 1.00
R7449:Eva1c UTSW 16 90,673,081 (GRCm39) critical splice donor site probably null
R8489:Eva1c UTSW 16 90,672,999 (GRCm39) missense probably damaging 1.00
R8687:Eva1c UTSW 16 90,687,433 (GRCm39) missense probably benign 0.42
R9091:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
R9270:Eva1c UTSW 16 90,701,231 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGCTCTGAAATCTGTGCAGG -3'
(R):5'- AGCAAGTAGTAGCTCACCTGC -3'

Sequencing Primer
(F):5'- CTCTGAAATCTGTGCAGGAATGG -3'
(R):5'- GTAGTAGCTCACCTGCAAAAATG -3'
Posted On 2018-06-22