Incidental Mutation 'R6605:Ifit2'
ID525645
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 34573497 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 146 (R146*)
Ref Sequence ENSEMBL: ENSMUSP00000099890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect probably null
Transcript: ENSMUST00000102826
AA Change: R146*
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: R146*

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149829
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0682:Ifit2 UTSW 19 34573612 missense probably benign 0.13
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4011:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4359:Ifit2 UTSW 19 34573144 missense possibly damaging 0.85
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5424:Ifit2 UTSW 19 34574058 missense probably benign 0.19
R5528:Ifit2 UTSW 19 34573537 missense possibly damaging 0.63
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
R8090:Ifit2 UTSW 19 34573262 missense possibly damaging 0.70
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTGCAATGCTTAGGGGAAG -3'
(R):5'- TGAATGGCTTGCTCCAGAGAG -3'

Sequencing Primer
(F):5'- TGAGGGCTTCATCCAGCAACAG -3'
(R):5'- TTGCTCCAGAGAGTCAATGC -3'
Posted On2018-06-22