Incidental Mutation 'R6605:Gucy2g'
ID525647
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55241028 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 70 (Q70L)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably damaging
Transcript: ENSMUST00000069183
AA Change: Q70L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: Q70L

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R7963:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAATACTCCGTACTCTACCTCTG -3'
(R):5'- ATGGCTTCTAGGACACGCTC -3'

Sequencing Primer
(F):5'- CTGCTGCTTCTGGGCATGC -3'
(R):5'- TCTGAGTCTCCACTAGAACCTAGG -3'
Posted On2018-06-22