Incidental Mutation 'R6605:Pnlip'
ID525649
Institutional Source Beutler Lab
Gene Symbol Pnlip
Ensembl Gene ENSMUSG00000046008
Gene Namepancreatic lipase
Synonymspancreatic triglyceride lipase, PTL, 1810007A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58670365-58681786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58671742 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 29 (D29V)
Ref Sequence ENSEMBL: ENSMUSP00000056377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057270]
Predicted Effect probably benign
Transcript: ENSMUST00000057270
AA Change: D29V

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000056377
Gene: ENSMUSG00000046008
AA Change: D29V

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipase 17 352 2.4e-164 PFAM
LH2 355 465 4.47e-25 SMART
Meta Mutation Damage Score 0.4568 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipase family of proteins. The encoded enzyme is secreted by the pancreas and hydrolyzes triglycerides in the small intestine, and is essential for the efficient digestion of dietary fats. Inhibition of the encoded enzyme may prevent high-fat diet-induced obesity in mice and result in weight loss in human patients with obesity. Mutations in this gene cause congenital pancreatic lipase deficiency, a rare disorder characterized by steatorrhea. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice show impaired dietary cholesterol, triglyceride and retinyl ester absorption, resistance to diet-induced obesity, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Prdm4 A G 10: 85,904,138 V459A probably benign Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Pnlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02257:Pnlip APN 19 58673874 missense probably benign 0.00
IGL02733:Pnlip APN 19 58680788 missense probably benign
R1121:Pnlip UTSW 19 58680908 splice site probably null
R2145:Pnlip UTSW 19 58676444 missense probably benign 0.11
R2213:Pnlip UTSW 19 58673770 missense probably benign 0.07
R3405:Pnlip UTSW 19 58680759 missense probably benign
R4703:Pnlip UTSW 19 58676467 missense probably damaging 1.00
R4731:Pnlip UTSW 19 58676487 missense probably benign 0.00
R4909:Pnlip UTSW 19 58676240 missense possibly damaging 0.85
R5386:Pnlip UTSW 19 58679607 missense probably benign 0.25
R5444:Pnlip UTSW 19 58673163 missense probably benign 0.00
R5851:Pnlip UTSW 19 58673792 nonsense probably null
R6515:Pnlip UTSW 19 58673115 missense probably damaging 1.00
R6974:Pnlip UTSW 19 58679635 critical splice donor site probably null
R7057:Pnlip UTSW 19 58676263 missense probably damaging 1.00
R7312:Pnlip UTSW 19 58681702 missense probably damaging 0.97
R7358:Pnlip UTSW 19 58676544 missense probably damaging 1.00
R7476:Pnlip UTSW 19 58679634 critical splice donor site probably null
R7674:Pnlip UTSW 19 58675154 missense possibly damaging 0.70
R7800:Pnlip UTSW 19 58681702 missense probably benign 0.18
R7983:Pnlip UTSW 19 58680059 missense probably benign 0.04
X0025:Pnlip UTSW 19 58680810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATCCTTGAGCAGAGACCTGTG -3'
(R):5'- CCTTAATCTGATTGCTCTAGAAGTC -3'

Sequencing Primer
(F):5'- AGGTGACGGTCAGTAGCCTG -3'
(R):5'- CTGATTGCTCTAGAAGTCTAAACAG -3'
Posted On2018-06-22