Mutagenetix > Incidental Mutation

Incidental Mutation 'R6639:Cfap57'

525650

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

044760-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6639 (G1)

Quality Score

173.009

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118554712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1245 (E1245G)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably benign
Transcript: ENSMUST00000071972
AA Change: E1245G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: E1245G

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921
AA Change: E1245G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: E1245G

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.1016

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	A	G	14: 8,536,530	S226P	probably benign	Het
Adgb	T	G	10: 10,435,956	I238L	possibly damaging	Het
Ankrd33b	T	C	15: 31,297,672	Y313C	probably damaging	Het
Capn15	C	T	17: 25,960,178	V940I	probably benign	Het
Cdh3	G	C	8: 106,511,341	V56L	probably benign	Het
Depdc7	C	T	2: 104,724,753	D271N	probably damaging	Het
Dmtn	T	C	14: 70,617,430	D10G	probably damaging	Het
Dusp12	T	C	1: 170,880,674	E158G	probably damaging	Het
Egf	C	T	3: 129,736,832	G227D	probably benign	Het
Epha1	C	A	6: 42,365,935	E227*	probably null	Het
Fbxo40	A	T	16: 36,970,575	C58S	probably damaging	Het
Focad	A	G	4: 88,278,242	T611A	unknown	Het
Fpr-rs4	C	T	17: 18,022,132	Q134*	probably null	Het
Fsip2	G	A	2: 82,983,227	D3297N	possibly damaging	Het
Garnl3	T	C	2: 32,989,525	R930G	possibly damaging	Het
Hdac4	A	T	1: 91,970,948	C695S	probably damaging	Het
Ier2	G	A	8: 84,662,162	T197M	probably benign	Het
Ift74	T	A	4: 94,664,259		probably benign	Het
Kat6b	A	G	14: 21,517,494	D207G	possibly damaging	Het
Khdrbs2	A	T	1: 32,467,862	R196*	probably null	Het
Naip6	C	A	13: 100,300,401	S538I	probably benign	Het
Nrip1	G	A	16: 76,293,995	Q225*	probably null	Het
Olfr114	A	G	17: 37,589,931	C141R	probably damaging	Het
Olfr354	G	A	2: 36,907,678	C244Y	probably damaging	Het
Pdrg1	T	C	2: 153,015,271	E17G	probably damaging	Het
R3hdm1	GAA	GAAA	1: 128,162,811		probably null	Het
Rnf17	C	T	14: 56,438,743	P354S	probably benign	Het
Sh3rf3	T	A	10: 59,083,467	Y469N	probably damaging	Het
Thoc6	T	A	17: 23,670,454		probably null	Het
Tpm3	C	G	3: 90,079,802	A24G	probably damaging	Het
Tuft1	T	C	3: 94,632,623	M93V	probably benign	Het
Vmn1r22	T	C	6: 57,900,714	I93V	probably benign	Het
Zfp383	T	C	7: 29,914,727	S136P	probably benign	Het
Zfp748	T	C	13: 67,542,905	K79E	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGTAGTCACCACCAGTCCTC -3'
(R):5'- CTCTACTATGAGGCTGAACGAAC -3'

Sequencing Primer
(F):5'- TAGTCACCACCAGTCCTCAGGTAC -3'
(R):5'- CTACTATGAGGCTGAACGAACAGGAG -3'

Posted On

2018-06-22