Incidental Mutation 'R6606:Fbln7'
ID525664
Institutional Source Beutler Lab
Gene Symbol Fbln7
Ensembl Gene ENSMUSG00000027386
Gene Namefibulin 7
Synonyms1600015H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6606 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128862981-128897034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128877376 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 31 (Q31R)
Ref Sequence ENSEMBL: ENSMUSP00000105953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028864] [ENSMUST00000110324]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028864
AA Change: Q31R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028864
Gene: ENSMUSG00000027386
AA Change: Q31R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
CCP 81 134 7.5e-15 SMART
EGF_CA 136 172 1.46e-7 SMART
low complexity region 177 189 N/A INTRINSIC
EGF_CA 225 270 2.08e-12 SMART
EGF 274 320 1.95e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110324
AA Change: Q31R

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105953
Gene: ENSMUSG00000027386
AA Change: Q31R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
CCP 81 134 7.5e-15 SMART
EGF_CA 136 172 1.46e-7 SMART
low complexity region 177 189 N/A INTRINSIC
EGF_CA 225 270 2.08e-12 SMART
EGF 274 320 1.95e1 SMART
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal A G 2: 121,150,288 E21G probably damaging Het
Ankk1 T C 9: 49,416,346 Y511C probably benign Het
Atn1 G A 6: 124,744,956 probably benign Het
Ccnt2 C A 1: 127,803,241 S618R probably benign Het
Ces4a A G 8: 105,149,378 N517S possibly damaging Het
Chd4 C A 6: 125,109,426 T963K probably damaging Het
Crlf1 A G 8: 70,501,174 Y310C probably damaging Het
Cyyr1 A G 16: 85,457,550 Y155H probably benign Het
Dnah3 A T 7: 120,060,956 I831N probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Echdc1 A G 10: 29,313,715 I17V probably benign Het
Ephx4 G T 5: 107,413,065 V28F probably damaging Het
Erich6 A G 3: 58,616,500 I651T probably damaging Het
Fbxl17 A G 17: 63,487,788 V433A probably damaging Het
Gm20449 T C 7: 41,458,829 E39G unknown Het
Gprc5b G A 7: 118,984,073 P191L probably benign Het
Klhl1 T C 14: 96,123,222 T731A possibly damaging Het
Myo3b A G 2: 70,232,485 D371G possibly damaging Het
Olfr148 G A 9: 39,614,082 V172M probably damaging Het
P4ha3 G T 7: 100,305,644 C303F probably damaging Het
Parp10 C A 15: 76,240,108 V782L possibly damaging Het
Prpf40a A G 2: 53,151,751 S501P probably damaging Het
Ptpn3 A T 4: 57,265,104 probably null Het
Ptprz1 A C 6: 23,002,501 H1530P probably benign Het
Rasa4 A G 5: 136,103,947 K18E probably damaging Het
Rit1 A G 3: 88,717,638 E48G probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rspo3 C T 10: 29,454,281 R228K unknown Het
Scai A T 2: 39,075,135 S566T probably benign Het
Scn4a T C 11: 106,328,073 E973G probably benign Het
Slc15a3 T A 19: 10,848,682 F246I possibly damaging Het
Stfa3 T C 16: 36,455,285 D27G possibly damaging Het
Uba5 T C 9: 104,055,221 D181G probably damaging Het
Urb1 T C 16: 90,810,268 T25A probably benign Het
Zbtb43 G T 2: 33,455,054 S16Y probably damaging Het
Zyg11b G A 4: 108,236,089 A717V probably benign Het
Other mutations in Fbln7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Fbln7 APN 2 128893851 missense possibly damaging 0.93
IGL02161:Fbln7 APN 2 128889791 missense probably benign 0.23
IGL02383:Fbln7 APN 2 128895557 missense probably benign 0.00
IGL03273:Fbln7 APN 2 128895470 missense probably benign 0.00
R0463:Fbln7 UTSW 2 128877511 missense probably benign 0.06
R0541:Fbln7 UTSW 2 128877534 splice site probably benign
R1036:Fbln7 UTSW 2 128893895 missense possibly damaging 0.84
R1381:Fbln7 UTSW 2 128877379 missense probably damaging 1.00
R1466:Fbln7 UTSW 2 128877429 missense probably benign 0.00
R1466:Fbln7 UTSW 2 128877429 missense probably benign 0.00
R1584:Fbln7 UTSW 2 128877429 missense probably benign 0.00
R1769:Fbln7 UTSW 2 128893762 splice site probably benign
R1855:Fbln7 UTSW 2 128893835 missense possibly damaging 0.65
R2065:Fbln7 UTSW 2 128877466 missense probably damaging 0.99
R2066:Fbln7 UTSW 2 128877466 missense probably damaging 0.99
R2067:Fbln7 UTSW 2 128877466 missense probably damaging 0.99
R4666:Fbln7 UTSW 2 128894910 splice site probably null
R4679:Fbln7 UTSW 2 128894886 missense probably damaging 1.00
R4694:Fbln7 UTSW 2 128880425 splice site probably null
R5933:Fbln7 UTSW 2 128877498 missense probably benign
R6211:Fbln7 UTSW 2 128895340 missense probably damaging 1.00
R7519:Fbln7 UTSW 2 128893865 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATCCAGAAGTGAGGGGTGC -3'
(R):5'- TGCACACGTGAAGGATAAACTG -3'

Sequencing Primer
(F):5'- CCTTGGAATGGCTGATCTACCAAG -3'
(R):5'- AGGTGTTGTTCTTGGCCCTCAC -3'
Posted On2018-06-22