Incidental Mutation 'R6639:Rnf17'
ID 525673
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Name ring finger protein 17
Synonyms MMIP-2
MMRRC Submission 044760-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.522) question?
Stock # R6639 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56640107-56762489 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56676200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 354 (P354S)
Ref Sequence ENSEMBL: ENSMUSP00000153222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
AlphaFold Q99MV7
Predicted Effect probably benign
Transcript: ENSMUST00000095793
AA Change: P354S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: P354S

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223627
AA Change: P354S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225361
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb T G 10: 10,311,700 (GRCm39) I238L possibly damaging Het
Ankrd33b T C 15: 31,297,818 (GRCm39) Y313C probably damaging Het
Capn15 C T 17: 26,179,152 (GRCm39) V940I probably benign Het
Cdh3 G C 8: 107,237,973 (GRCm39) V56L probably benign Het
Cfap20dc A G 14: 8,536,530 (GRCm38) S226P probably benign Het
Cfap57 T C 4: 118,411,909 (GRCm39) E1245G probably benign Het
Depdc7 C T 2: 104,555,098 (GRCm39) D271N probably damaging Het
Dmtn T C 14: 70,854,870 (GRCm39) D10G probably damaging Het
Dusp12 T C 1: 170,708,243 (GRCm39) E158G probably damaging Het
Egf C T 3: 129,530,481 (GRCm39) G227D probably benign Het
Epha1 C A 6: 42,342,869 (GRCm39) E227* probably null Het
Fbxo40 A T 16: 36,790,937 (GRCm39) C58S probably damaging Het
Focad A G 4: 88,196,479 (GRCm39) T611A unknown Het
Fpr-rs4 C T 17: 18,242,394 (GRCm39) Q134* probably null Het
Fsip2 G A 2: 82,813,571 (GRCm39) D3297N possibly damaging Het
Garnl3 T C 2: 32,879,537 (GRCm39) R930G possibly damaging Het
Hdac4 A T 1: 91,898,670 (GRCm39) C695S probably damaging Het
Ier2 G A 8: 85,388,791 (GRCm39) T197M probably benign Het
Ift74 T A 4: 94,552,496 (GRCm39) probably benign Het
Kat6b A G 14: 21,567,562 (GRCm39) D207G possibly damaging Het
Khdrbs2 A T 1: 32,506,943 (GRCm39) R196* probably null Het
Naip6 C A 13: 100,436,909 (GRCm39) S538I probably benign Het
Nrip1 G A 16: 76,090,883 (GRCm39) Q225* probably null Het
Or14j3 A G 17: 37,900,822 (GRCm39) C141R probably damaging Het
Or1n2 G A 2: 36,797,690 (GRCm39) C244Y probably damaging Het
Pdrg1 T C 2: 152,857,191 (GRCm39) E17G probably damaging Het
R3hdm1 GAA GAAA 1: 128,090,548 (GRCm39) probably null Het
Sh3rf3 T A 10: 58,919,289 (GRCm39) Y469N probably damaging Het
Thoc6 T A 17: 23,889,428 (GRCm39) probably null Het
Tpm3 C G 3: 89,987,109 (GRCm39) A24G probably damaging Het
Tuft1 T C 3: 94,539,930 (GRCm39) M93V probably benign Het
Vmn1r22 T C 6: 57,877,699 (GRCm39) I93V probably benign Het
Zfp383 T C 7: 29,614,152 (GRCm39) S136P probably benign Het
Zfp748 T C 13: 67,691,024 (GRCm39) K79E probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56,658,539 (GRCm39) missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56,703,207 (GRCm39) missense probably benign 0.00
IGL00978:Rnf17 APN 14 56,749,728 (GRCm39) missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56,700,521 (GRCm39) nonsense probably null
IGL01779:Rnf17 APN 14 56,699,520 (GRCm39) missense probably benign 0.06
IGL02132:Rnf17 APN 14 56,658,623 (GRCm39) missense probably benign 0.27
IGL02183:Rnf17 APN 14 56,745,325 (GRCm39) missense probably null 0.99
IGL02387:Rnf17 APN 14 56,738,044 (GRCm39) missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56,719,592 (GRCm39) missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56,671,828 (GRCm39) missense probably benign 0.03
IGL03269:Rnf17 APN 14 56,665,403 (GRCm39) missense possibly damaging 0.74
divest UTSW 14 56,661,999 (GRCm39) frame shift probably null
Shed UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56,708,830 (GRCm39) missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56,708,830 (GRCm39) missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56,751,563 (GRCm39) missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56,719,650 (GRCm39) missense probably null 1.00
R0243:Rnf17 UTSW 14 56,719,541 (GRCm39) missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56,676,066 (GRCm39) missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56,751,632 (GRCm39) missense probably benign 0.43
R0554:Rnf17 UTSW 14 56,760,007 (GRCm39) missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56,712,904 (GRCm39) missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56,751,622 (GRCm39) missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56,663,088 (GRCm39) missense probably benign 0.10
R1200:Rnf17 UTSW 14 56,705,163 (GRCm39) missense probably benign 0.44
R1464:Rnf17 UTSW 14 56,699,368 (GRCm39) missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56,699,368 (GRCm39) missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56,665,436 (GRCm39) missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56,705,243 (GRCm39) missense probably benign 0.01
R1605:Rnf17 UTSW 14 56,730,822 (GRCm39) missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56,759,856 (GRCm39) missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56,741,464 (GRCm39) nonsense probably null
R2015:Rnf17 UTSW 14 56,724,426 (GRCm39) missense probably benign 0.00
R2023:Rnf17 UTSW 14 56,669,036 (GRCm39) missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56,720,837 (GRCm39) missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56,730,811 (GRCm39) missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56,743,439 (GRCm39) missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56,738,004 (GRCm39) missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56,705,197 (GRCm39) missense probably benign 0.43
R3847:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56,749,753 (GRCm39) missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56,712,870 (GRCm39) missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56,712,870 (GRCm39) missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56,697,458 (GRCm39) missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56,697,458 (GRCm39) missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56,671,812 (GRCm39) missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56,759,848 (GRCm39) missense probably benign 0.02
R5068:Rnf17 UTSW 14 56,743,385 (GRCm39) missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56,743,385 (GRCm39) missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56,743,385 (GRCm39) missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56,719,590 (GRCm39) missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56,724,409 (GRCm39) splice site probably null
R5712:Rnf17 UTSW 14 56,708,856 (GRCm39) missense probably benign 0.19
R5747:Rnf17 UTSW 14 56,703,276 (GRCm39) critical splice donor site probably null
R5869:Rnf17 UTSW 14 56,743,445 (GRCm39) missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56,658,626 (GRCm39) splice site probably null
R6626:Rnf17 UTSW 14 56,665,381 (GRCm39) missense possibly damaging 0.92
R6675:Rnf17 UTSW 14 56,697,432 (GRCm39) missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56,761,807 (GRCm39) missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56,703,111 (GRCm39) missense probably benign 0.00
R7103:Rnf17 UTSW 14 56,708,763 (GRCm39) missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56,749,789 (GRCm39) splice site probably null
R7527:Rnf17 UTSW 14 56,753,895 (GRCm39) missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56,676,335 (GRCm39) missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56,699,529 (GRCm39) critical splice donor site probably null
R7772:Rnf17 UTSW 14 56,715,144 (GRCm39) missense probably benign 0.27
R8092:Rnf17 UTSW 14 56,724,479 (GRCm39) missense probably benign 0.00
R8150:Rnf17 UTSW 14 56,658,593 (GRCm39) missense probably benign 0.19
R8203:Rnf17 UTSW 14 56,705,179 (GRCm39) missense probably benign 0.17
R8320:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8321:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8379:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8380:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8381:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8382:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8383:Rnf17 UTSW 14 56,661,999 (GRCm39) frame shift probably null
R8799:Rnf17 UTSW 14 56,737,886 (GRCm39) missense probably damaging 1.00
R8850:Rnf17 UTSW 14 56,722,658 (GRCm39) missense probably damaging 1.00
R9212:Rnf17 UTSW 14 56,761,785 (GRCm39) missense probably damaging 1.00
R9276:Rnf17 UTSW 14 56,719,554 (GRCm39) missense probably damaging 1.00
R9300:Rnf17 UTSW 14 56,697,495 (GRCm39) missense possibly damaging 0.79
R9375:Rnf17 UTSW 14 56,719,579 (GRCm39) missense probably damaging 1.00
R9664:Rnf17 UTSW 14 56,722,636 (GRCm39) missense probably damaging 1.00
Z1177:Rnf17 UTSW 14 56,705,163 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTCACACTGTCACTAACAAATGAG -3'
(R):5'- ACAGCATGTTTCTACTAAGCACATG -3'

Sequencing Primer
(F):5'- GTCACTAACAAATGAGCAAGAAATAG -3'
(R):5'- TATCACATCAGGGCTGGA -3'
Posted On 2018-06-22