Incidental Mutation 'R6639:Rnf17'
ID525673
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R6639 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56438743 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 354 (P354S)
Ref Sequence ENSEMBL: ENSMUSP00000153222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]
Predicted Effect probably benign
Transcript: ENSMUST00000095793
AA Change: P354S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: P354S

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223627
AA Change: P354S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225361
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,530 S226P probably benign Het
Adgb T G 10: 10,435,956 I238L possibly damaging Het
Ankrd33b T C 15: 31,297,672 Y313C probably damaging Het
Capn15 C T 17: 25,960,178 V940I probably benign Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Cfap57 T C 4: 118,554,712 E1245G probably benign Het
Depdc7 C T 2: 104,724,753 D271N probably damaging Het
Dmtn T C 14: 70,617,430 D10G probably damaging Het
Dusp12 T C 1: 170,880,674 E158G probably damaging Het
Egf C T 3: 129,736,832 G227D probably benign Het
Epha1 C A 6: 42,365,935 E227* probably null Het
Fbxo40 A T 16: 36,970,575 C58S probably damaging Het
Focad A G 4: 88,278,242 T611A unknown Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fsip2 G A 2: 82,983,227 D3297N possibly damaging Het
Garnl3 T C 2: 32,989,525 R930G possibly damaging Het
Hdac4 A T 1: 91,970,948 C695S probably damaging Het
Ier2 G A 8: 84,662,162 T197M probably benign Het
Ift74 T A 4: 94,664,259 probably benign Het
Kat6b A G 14: 21,517,494 D207G possibly damaging Het
Khdrbs2 A T 1: 32,467,862 R196* probably null Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Nrip1 G A 16: 76,293,995 Q225* probably null Het
Olfr114 A G 17: 37,589,931 C141R probably damaging Het
Olfr354 G A 2: 36,907,678 C244Y probably damaging Het
Pdrg1 T C 2: 153,015,271 E17G probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Sh3rf3 T A 10: 59,083,467 Y469N probably damaging Het
Thoc6 T A 17: 23,670,454 probably null Het
Tpm3 C G 3: 90,079,802 A24G probably damaging Het
Tuft1 T C 3: 94,632,623 M93V probably benign Het
Vmn1r22 T C 6: 57,900,714 I93V probably benign Het
Zfp383 T C 7: 29,914,727 S136P probably benign Het
Zfp748 T C 13: 67,542,905 K79E probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8203:Rnf17 UTSW 14 56467722 missense probably benign 0.17
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTCACACTGTCACTAACAAATGAG -3'
(R):5'- ACAGCATGTTTCTACTAAGCACATG -3'

Sequencing Primer
(F):5'- GTCACTAACAAATGAGCAAGAAATAG -3'
(R):5'- TATCACATCAGGGCTGGA -3'
Posted On2018-06-22