Incidental Mutation 'R6639:Fpr-rs4'
ID525685
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Nameformyl peptide receptor, related sequence 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6639 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18021733-18022704 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 18022132 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 134 (Q134*)
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
Predicted Effect probably null
Transcript: ENSMUST00000095651
AA Change: Q134*
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062
AA Change: Q134*

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,530 S226P probably benign Het
Adgb T G 10: 10,435,956 I238L possibly damaging Het
Ankrd33b T C 15: 31,297,672 Y313C probably damaging Het
Capn15 C T 17: 25,960,178 V940I probably benign Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Cfap57 T C 4: 118,554,712 E1245G probably benign Het
Depdc7 C T 2: 104,724,753 D271N probably damaging Het
Dmtn T C 14: 70,617,430 D10G probably damaging Het
Dusp12 T C 1: 170,880,674 E158G probably damaging Het
Egf C T 3: 129,736,832 G227D probably benign Het
Epha1 C A 6: 42,365,935 E227* probably null Het
Fbxo40 A T 16: 36,970,575 C58S probably damaging Het
Focad A G 4: 88,278,242 T611A unknown Het
Fsip2 G A 2: 82,983,227 D3297N possibly damaging Het
Garnl3 T C 2: 32,989,525 R930G possibly damaging Het
Hdac4 A T 1: 91,970,948 C695S probably damaging Het
Ier2 G A 8: 84,662,162 T197M probably benign Het
Ift74 T A 4: 94,664,259 probably benign Het
Kat6b A G 14: 21,517,494 D207G possibly damaging Het
Khdrbs2 A T 1: 32,467,862 R196* probably null Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Nrip1 G A 16: 76,293,995 Q225* probably null Het
Olfr114 A G 17: 37,589,931 C141R probably damaging Het
Olfr354 G A 2: 36,907,678 C244Y probably damaging Het
Pdrg1 T C 2: 153,015,271 E17G probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rnf17 C T 14: 56,438,743 P354S probably benign Het
Sh3rf3 T A 10: 59,083,467 Y469N probably damaging Het
Thoc6 T A 17: 23,670,454 probably null Het
Tpm3 C G 3: 90,079,802 A24G probably damaging Het
Tuft1 T C 3: 94,632,623 M93V probably benign Het
Vmn1r22 T C 6: 57,900,714 I93V probably benign Het
Zfp383 T C 7: 29,914,727 S136P probably benign Het
Zfp748 T C 13: 67,542,905 K79E probably damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6076:Fpr-rs4 UTSW 17 18022055 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CACACTGTGACCACTGTCTC -3'
(R):5'- CTGCTCTTCAGAGGTTGCAACC -3'

Sequencing Primer
(F):5'- GACCACTGTCTCTTATCTGAACTTGG -3'
(R):5'- GGTTGCAACCCAGGATTCAAATTTAG -3'
Posted On2018-06-22