Incidental Mutation 'R6606:Crlf1'
ID525688
Institutional Source Beutler Lab
Gene Symbol Crlf1
Ensembl Gene ENSMUSG00000007888
Gene Namecytokine receptor-like factor 1
SynonymsCLF-1, cytokine receptor like molecule 3, CRLM3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R6606 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70493158-70504081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70501174 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 310 (Y310C)
Ref Sequence ENSEMBL: ENSMUSP00000008032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008032] [ENSMUST00000075175] [ENSMUST00000132648] [ENSMUST00000136913]
Predicted Effect probably damaging
Transcript: ENSMUST00000008032
AA Change: Y310C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008032
Gene: ENSMUSG00000007888
AA Change: Y310C

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:Lep_receptor_Ig 41 127 5.7e-8 PFAM
FN3 138 223 2.11e0 SMART
FN3 238 323 1.5e-5 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075175
SMART Domains Protein: ENSMUSP00000074670
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 1.5e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127983
AA Change: Y14C
SMART Domains Protein: ENSMUSP00000115614
Gene: ENSMUSG00000007888
AA Change: Y14C

DomainStartEndE-ValueType
Blast:FN3 2 28 2e-12 BLAST
SCOP:d1eerb2 2 46 1e-8 SMART
low complexity region 50 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132107
Predicted Effect probably benign
Transcript: ENSMUST00000132648
SMART Domains Protein: ENSMUSP00000119545
Gene: ENSMUSG00000007888

DomainStartEndE-ValueType
FN3 16 101 2.11e0 SMART
low complexity region 104 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135773
Predicted Effect probably benign
Transcript: ENSMUST00000136913
SMART Domains Protein: ENSMUSP00000120446
Gene: ENSMUSG00000058833

DomainStartEndE-ValueType
Pfam:DNA_repr_REX1B 29 128 4.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143598
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: This gene encodes a member of the cytokine type I receptor family. The encoded protein functions as a cytokine receptor subunit and may be involved in immune system regulation and fetal development. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation fail to suckle effectively and do not survive beyond 24 hrs after birth. Newborns exhibit reduced numbers of hematopoietic progenitor cells as well as a significant reduction in the number of motoneurons in the lumbar spinal cord and facial nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal A G 2: 121,150,288 E21G probably damaging Het
Ankk1 T C 9: 49,416,346 Y511C probably benign Het
Atn1 G A 6: 124,744,956 probably benign Het
Ccnt2 C A 1: 127,803,241 S618R probably benign Het
Ces4a A G 8: 105,149,378 N517S possibly damaging Het
Chd4 C A 6: 125,109,426 T963K probably damaging Het
Cyyr1 A G 16: 85,457,550 Y155H probably benign Het
Dnah3 A T 7: 120,060,956 I831N probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Echdc1 A G 10: 29,313,715 I17V probably benign Het
Ephx4 G T 5: 107,413,065 V28F probably damaging Het
Erich6 A G 3: 58,616,500 I651T probably damaging Het
Fbln7 A G 2: 128,877,376 Q31R possibly damaging Het
Fbxl17 A G 17: 63,487,788 V433A probably damaging Het
Gm20449 T C 7: 41,458,829 E39G unknown Het
Gprc5b G A 7: 118,984,073 P191L probably benign Het
Klhl1 T C 14: 96,123,222 T731A possibly damaging Het
Myo3b A G 2: 70,232,485 D371G possibly damaging Het
Olfr148 G A 9: 39,614,082 V172M probably damaging Het
P4ha3 G T 7: 100,305,644 C303F probably damaging Het
Parp10 C A 15: 76,240,108 V782L possibly damaging Het
Prpf40a A G 2: 53,151,751 S501P probably damaging Het
Ptpn3 A T 4: 57,265,104 probably null Het
Ptprz1 A C 6: 23,002,501 H1530P probably benign Het
Rasa4 A G 5: 136,103,947 K18E probably damaging Het
Rit1 A G 3: 88,717,638 E48G probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rspo3 C T 10: 29,454,281 R228K unknown Het
Scai A T 2: 39,075,135 S566T probably benign Het
Scn4a T C 11: 106,328,073 E973G probably benign Het
Slc15a3 T A 19: 10,848,682 F246I possibly damaging Het
Stfa3 T C 16: 36,455,285 D27G possibly damaging Het
Uba5 T C 9: 104,055,221 D181G probably damaging Het
Urb1 T C 16: 90,810,268 T25A probably benign Het
Zbtb43 G T 2: 33,455,054 S16Y probably damaging Het
Zyg11b G A 4: 108,236,089 A717V probably benign Het
Other mutations in Crlf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02878:Crlf1 APN 8 70503640 critical splice donor site probably null
R0317:Crlf1 UTSW 8 70498599 missense probably benign
R0398:Crlf1 UTSW 8 70499089 splice site probably benign
R0437:Crlf1 UTSW 8 70499514 splice site probably null
R1191:Crlf1 UTSW 8 70498828 missense probably damaging 1.00
R1741:Crlf1 UTSW 8 70500906 missense probably damaging 0.99
R3730:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R3731:Crlf1 UTSW 8 70499442 missense probably benign 0.03
R4467:Crlf1 UTSW 8 70500956 nonsense probably null
R5557:Crlf1 UTSW 8 70498667 missense probably benign 0.12
R6009:Crlf1 UTSW 8 70503479 missense probably damaging 1.00
R6348:Crlf1 UTSW 8 70493340 missense probably benign
R7947:Crlf1 UTSW 8 70499212 missense probably damaging 1.00
X0062:Crlf1 UTSW 8 70498837 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGTACCAGATCCGCTACCG -3'
(R):5'- AGTCTCCCAAAGGTGGTGATG -3'

Sequencing Primer
(F):5'- TACCGCGTGGAGGACAG -3'
(R):5'- GGTGCTCACCACTTCGA -3'
Posted On2018-06-22