Mutagenetix > Incidental Mutations

Incidental Mutation 'R6640:Dock10'

525695

Institutional Source

Beutler Lab

Gene Symbol

Dock10

Ensembl Gene

ENSMUSG00000038608

Gene Name

dedicator of cytokinesis 10

Synonyms

Jr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R6640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80501073-80758527 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 80533838 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 1518 (S1518*)

Ref Sequence

ENSEMBL: ENSMUSP00000140719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]

Predicted Effect

probably null
Transcript: ENSMUST00000077946
AA Change: S1531*

SMART Domains

Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: S1531*

Domain	Start	End	E-Value	Type
low complexity region	25	42	N/A	INTRINSIC
Pfam:DUF3398	61	153	1.7e-36	PFAM
PH	182	292	8.5e-17	SMART
Blast:PH	350	458	7e-18	BLAST
Pfam:DOCK-C2	668	859	1e-50	PFAM
low complexity region	1269	1279	N/A	INTRINSIC
low complexity region	1284	1295	N/A	INTRINSIC
Pfam:DHR-2	1592	2143	1.3e-216	PFAM
low complexity region	2174	2187	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000187774
AA Change: S1519*

SMART Domains

Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: S1519*

Domain	Start	End	E-Value	Type
Pfam:DUF3398	46	141	9e-29	PFAM
PH	170	280	3.9e-19	SMART
Blast:PH	338	446	7e-18	BLAST
Pfam:DOCK-C2	655	848	1.5e-54	PFAM
low complexity region	1257	1267	N/A	INTRINSIC
low complexity region	1272	1283	N/A	INTRINSIC
low complexity region	1870	1890	N/A	INTRINSIC
Pfam:Ded_cyto	1954	2131	3.4e-65	PFAM
low complexity region	2162	2175	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189486

Predicted Effect

probably null
Transcript: ENSMUST00000190595
AA Change: S1184*

SMART Domains

Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: S1184*

Domain	Start	End	E-Value	Type
Blast:PH	3	111	5e-18	BLAST
Pfam:DOCK-C2	320	513	1.2e-54	PFAM
low complexity region	922	932	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	1508	1522	N/A	INTRINSIC
Pfam:Ded_cyto	1588	1765	2.7e-65	PFAM
low complexity region	1783	1795	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000190983
AA Change: S1518*

SMART Domains

Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: S1518*

Domain	Start	End	E-Value	Type
Pfam:DUF3398	45	140	8.9e-29	PFAM
PH	169	279	3.9e-19	SMART
Blast:PH	337	445	7e-18	BLAST
Pfam:DOCK-C2	654	847	1.5e-54	PFAM
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1271	1282	N/A	INTRINSIC
low complexity region	1869	1889	N/A	INTRINSIC
Pfam:Ded_cyto	1953	2130	3.4e-65	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

97% (31/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,553,285	N936K	probably benign	Het
Abca2	A	T	2: 25,447,003	Y2318F	possibly damaging	Het
Aldh1b1	A	G	4: 45,803,868	T469A	possibly damaging	Het
Ccdc136	A	G	6: 29,412,960	D382G	possibly damaging	Het
Dapk1	A	G	13: 60,716,814	K141E	probably damaging	Het
Dnah6	A	T	6: 73,024,293	W3973R	probably damaging	Het
Doxl2	A	G	6: 48,977,671	D581G	probably benign	Het
Elovl5	C	A	9: 77,979,913	Y195*	probably null	Het
Fbxl21	T	A	13: 56,537,009	W309R	probably damaging	Het
Gm10020	G	T	15: 52,477,620		noncoding transcript	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gpx1	A	G	9: 108,340,096	D133G	probably damaging	Het
Hoxd1	T	A	2: 74,763,262	V54E	probably damaging	Het
Kcnh3	T	C	15: 99,241,768	V876A	probably benign	Het
Klri2	G	C	6: 129,732,195	F231L	probably benign	Het
Mogat1	T	G	1: 78,523,774	S158R	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Olfr1008	T	A	2: 85,689,935	C169S	probably damaging	Het
Olfr695	T	A	7: 106,714,040	I214F	probably damaging	Het
Otog	G	A	7: 46,261,743	A673T	possibly damaging	Het
Pigm	T	C	1: 172,377,687	V330A	probably damaging	Het
Rab33b	A	G	3: 51,484,479	T50A	possibly damaging	Het
Raver2	C	T	4: 101,131,303	P371L	probably damaging	Het
Sh3rf2	T	A	18: 42,101,640	Y163N	probably damaging	Het
Slc1a1	T	C	19: 28,894,570		probably null	Het
Slc6a18	T	A	13: 73,664,282	Y563F	possibly damaging	Het
Sp3	A	G	2: 72,971,114	L185P	possibly damaging	Het
Thbs2	T	C	17: 14,673,368	D850G	possibly damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmtc2	T	A	10: 105,573,749	M1L	probably benign	Het
Trpm2	C	T	10: 77,937,826	R585Q	probably benign	Het
Trpm3	T	A	19: 22,978,582	I1126K	probably damaging	Het
Ugt1a6b	A	C	1: 88,107,794	T285P	probably benign	Het
Vps13b	A	G	15: 35,617,696	T1181A	possibly damaging	Het

Other mutations in Dock10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Dock10	APN	1	80585012	missense	probably damaging	1.00
IGL00783:Dock10	APN	1	80572449	splice site	probably benign
IGL00784:Dock10	APN	1	80572449	splice site	probably benign
IGL00858:Dock10	APN	1	80568003	missense	possibly damaging	0.48
IGL01298:Dock10	APN	1	80531245	missense	probably damaging	1.00
IGL01351:Dock10	APN	1	80593159	missense	probably damaging	1.00
IGL01356:Dock10	APN	1	80523742	missense	probably damaging	1.00
IGL01584:Dock10	APN	1	80533850	missense	probably damaging	0.99
IGL01619:Dock10	APN	1	80634298	splice site	probably benign
IGL01678:Dock10	APN	1	80543352	missense	probably damaging	1.00
IGL01759:Dock10	APN	1	80526273	missense	probably damaging	1.00
IGL02238:Dock10	APN	1	80533793	missense	probably damaging	0.99
IGL02352:Dock10	APN	1	80505661	missense	probably damaging	1.00
IGL02359:Dock10	APN	1	80505661	missense	probably damaging	1.00
IGL02377:Dock10	APN	1	80584994	critical splice donor site	probably null
IGL02433:Dock10	APN	1	80530188	missense	probably damaging	1.00
IGL02471:Dock10	APN	1	80515622	missense	probably damaging	0.99
IGL02645:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02646:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02648:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02649:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02650:Dock10	APN	1	80574123	missense	probably damaging	1.00
IGL02652:Dock10	APN	1	80592844	unclassified	probably null
IGL02718:Dock10	APN	1	80523818	missense	probably benign	0.00
IGL02998:Dock10	APN	1	80573542	missense	probably damaging	1.00
IGL03057:Dock10	APN	1	80567371	missense	probably damaging	1.00
IGL03066:Dock10	APN	1	80585041	missense	probably benign	0.00
IGL03106:Dock10	APN	1	80568834	missense	probably damaging	0.98
IGL03148:Dock10	APN	1	80540358	missense	probably benign	0.01
IGL03271:Dock10	APN	1	80505409	missense	probably damaging	1.00
IGL03352:Dock10	APN	1	80606296	splice site	probably benign
LCD18:Dock10	UTSW	1	80716623	intron	probably benign
PIT4366001:Dock10	UTSW	1	80595721	missense	probably benign	0.30
PIT4581001:Dock10	UTSW	1	80505446	missense	probably damaging	1.00
R0019:Dock10	UTSW	1	80605925	missense	probably damaging	1.00
R0081:Dock10	UTSW	1	80606578	missense	probably damaging	0.99
R0095:Dock10	UTSW	1	80524071	missense	probably benign	0.00
R0241:Dock10	UTSW	1	80578623	missense	probably benign
R0241:Dock10	UTSW	1	80578623	missense	probably benign
R0255:Dock10	UTSW	1	80605876	missense	probably damaging	1.00
R0267:Dock10	UTSW	1	80512454	missense	probably damaging	1.00
R0299:Dock10	UTSW	1	80536929	missense	probably damaging	0.99
R0365:Dock10	UTSW	1	80595683	missense	probably damaging	1.00
R0387:Dock10	UTSW	1	80540276	missense	probably damaging	1.00
R0403:Dock10	UTSW	1	80524070	missense	possibly damaging	0.94
R0408:Dock10	UTSW	1	80540476	missense	probably benign	0.03
R0414:Dock10	UTSW	1	80535933	missense	possibly damaging	0.93
R0591:Dock10	UTSW	1	80541219	splice site	probably benign
R0698:Dock10	UTSW	1	80530178	missense	probably damaging	1.00
R0711:Dock10	UTSW	1	80523975	missense	probably damaging	1.00
R0925:Dock10	UTSW	1	80536940	missense	probably benign	0.20
R1162:Dock10	UTSW	1	80568842	missense	possibly damaging	0.58
R1370:Dock10	UTSW	1	80540343	missense	probably damaging	1.00
R1440:Dock10	UTSW	1	80549136	missense	probably benign	0.03
R1469:Dock10	UTSW	1	80512558	missense	probably benign	0.05
R1469:Dock10	UTSW	1	80512558	missense	probably benign	0.05
R1525:Dock10	UTSW	1	80606164	critical splice donor site	probably null
R1544:Dock10	UTSW	1	80592635	missense	probably benign	0.00
R1601:Dock10	UTSW	1	80549802	missense	probably benign	0.00
R1757:Dock10	UTSW	1	80533869	missense	probably damaging	1.00
R1765:Dock10	UTSW	1	80605823	missense	probably damaging	1.00
R1783:Dock10	UTSW	1	80574180	missense	probably benign	0.17
R1823:Dock10	UTSW	1	80543097	splice site	probably null
R1827:Dock10	UTSW	1	80530292	missense	probably benign	0.07
R1844:Dock10	UTSW	1	80543201	missense	probably damaging	0.99
R1856:Dock10	UTSW	1	80606568	missense	possibly damaging	0.46
R1974:Dock10	UTSW	1	80510426	missense	possibly damaging	0.50
R2006:Dock10	UTSW	1	80549789	missense	possibly damaging	0.95
R2112:Dock10	UTSW	1	80505642	missense	probably damaging	1.00
R2112:Dock10	UTSW	1	80505643	missense	probably damaging	0.99
R2113:Dock10	UTSW	1	80606563	missense	probably damaging	1.00
R2439:Dock10	UTSW	1	80532432	missense	probably damaging	1.00
R2566:Dock10	UTSW	1	80540253	missense	possibly damaging	0.88
R3086:Dock10	UTSW	1	80532357	missense	possibly damaging	0.91
R3766:Dock10	UTSW	1	80536926	missense	probably damaging	0.99
R3768:Dock10	UTSW	1	80532368	missense	probably damaging	1.00
R4009:Dock10	UTSW	1	80532431	missense	probably damaging	1.00
R4016:Dock10	UTSW	1	80606569	missense	probably damaging	1.00
R4179:Dock10	UTSW	1	80510417	missense	probably benign	0.00
R4243:Dock10	UTSW	1	80566755	missense	probably benign	0.00
R4244:Dock10	UTSW	1	80566755	missense	probably benign	0.00
R4245:Dock10	UTSW	1	80566755	missense	probably benign	0.00
R4674:Dock10	UTSW	1	80606620	missense	possibly damaging	0.79
R4696:Dock10	UTSW	1	80515613	missense	possibly damaging	0.95
R4789:Dock10	UTSW	1	80541281	missense	probably damaging	1.00
R4851:Dock10	UTSW	1	80549157	missense	probably benign	0.33
R4911:Dock10	UTSW	1	80606236	missense	probably damaging	1.00
R4976:Dock10	UTSW	1	80567994	critical splice donor site	probably null
R5086:Dock10	UTSW	1	80551472	missense	possibly damaging	0.89
R5119:Dock10	UTSW	1	80567994	critical splice donor site	probably null
R5301:Dock10	UTSW	1	80648256	missense	probably benign	0.41
R5404:Dock10	UTSW	1	80503913	intron	probably benign
R5457:Dock10	UTSW	1	80524064	missense	probably damaging	1.00
R5790:Dock10	UTSW	1	80505170	missense	probably benign	0.00
R5845:Dock10	UTSW	1	80505742	intron	probably benign
R5871:Dock10	UTSW	1	80541340	critical splice acceptor site	probably null
R5873:Dock10	UTSW	1	80574138	missense	probably damaging	1.00
R5881:Dock10	UTSW	1	80560923	missense	probably benign	0.19
R5895:Dock10	UTSW	1	80536959	missense	probably benign
R5935:Dock10	UTSW	1	80505587	intron	probably benign
R5965:Dock10	UTSW	1	80568744	splice site	probably null
R5966:Dock10	UTSW	1	80568508	missense	possibly damaging	0.84
R6008:Dock10	UTSW	1	80606173	missense	probably damaging	0.98
R6029:Dock10	UTSW	1	80536946	missense	possibly damaging	0.68
R6083:Dock10	UTSW	1	80532431	missense	probably damaging	1.00
R6145:Dock10	UTSW	1	80575904	nonsense	probably null
R6257:Dock10	UTSW	1	80503696	intron	probably benign
R6274:Dock10	UTSW	1	80538823	missense	probably damaging	1.00
R6324:Dock10	UTSW	1	80505176	missense	probably benign	0.03
R6346:Dock10	UTSW	1	80575856	splice site	probably null
R6476:Dock10	UTSW	1	80541242	nonsense	probably null
R6516:Dock10	UTSW	1	80540461	missense	probably damaging	1.00
R6526:Dock10	UTSW	1	80586351	missense	probably damaging	0.97
R6534:Dock10	UTSW	1	80503671	missense	probably benign	0.01
R6620:Dock10	UTSW	1	80592638	missense	probably benign	0.01
R6669:Dock10	UTSW	1	80592855	missense	probably damaging	1.00
R6672:Dock10	UTSW	1	80512531	missense	probably benign	0.00
R6679:Dock10	UTSW	1	80566797	missense	probably benign	0.11
R6682:Dock10	UTSW	1	80512621	missense	probably damaging	1.00
R6712:Dock10	UTSW	1	80536866	missense	probably benign	0.00
R6726:Dock10	UTSW	1	80512430	missense	probably damaging	1.00
R6788:Dock10	UTSW	1	80531245	missense	probably damaging	1.00
R6805:Dock10	UTSW	1	80586690	missense	probably benign
R6815:Dock10	UTSW	1	80538859	missense	possibly damaging	0.94
R6818:Dock10	UTSW	1	80615365	missense	possibly damaging	0.95
R6867:Dock10	UTSW	1	80531259	missense	probably damaging	1.00
R6964:Dock10	UTSW	1	80503648	intron	probably benign
R7026:Dock10	UTSW	1	80501787	missense	probably benign	0.40
R7084:Dock10	UTSW	1	80503856	missense
R7087:Dock10	UTSW	1	80592826	missense	probably benign
R7158:Dock10	UTSW	1	80586872	critical splice acceptor site	probably null
R7191:Dock10	UTSW	1	80540331	missense	possibly damaging	0.93
R7214:Dock10	UTSW	1	80568529	missense	probably benign	0.01
R7255:Dock10	UTSW	1	80543099	critical splice donor site	probably null
R7320:Dock10	UTSW	1	80549704	critical splice donor site	probably null
R7359:Dock10	UTSW	1	80709348	missense	probably benign	0.01
R7423:Dock10	UTSW	1	80523780	missense	possibly damaging	0.67
R7464:Dock10	UTSW	1	80540315	missense	probably damaging	0.99
R7483:Dock10	UTSW	1	80515566	missense	probably benign	0.01
R7487:Dock10	UTSW	1	80585048	missense	probably benign	0.00
R7789:Dock10	UTSW	1	80559213	missense	possibly damaging	0.82
RF021:Dock10	UTSW	1	80564573	critical splice acceptor site	probably null
X0025:Dock10	UTSW	1	80536920	missense	probably damaging	0.98
X0065:Dock10	UTSW	1	80541260	missense	probably damaging	1.00
Z1088:Dock10	UTSW	1	80532347	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAATGGACTGGTATCTAGTGAAAC -3'
(R):5'- AAACTTCCCTGAGAGCGTAGG -3'

Sequencing Primer
(F):5'- CTAGTGAAACCAAAATAGCATGAAAC -3'
(R):5'- CTTCCCTGAGAGCGTAGGAAAAATC -3'

Posted On

2018-06-22