Incidental Mutation 'R6606:Rspo3'
ID525699
Institutional Source Beutler Lab
Gene Symbol Rspo3
Ensembl Gene ENSMUSG00000019880
Gene NameR-spondin 3
Synonyms2810459H04Rik, Thsd2, Cristin1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6606 (G1)
Quality Score113.008
Status Validated
Chromosome10
Chromosomal Location29452416-29535867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29454281 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 228 (R228K)
Ref Sequence ENSEMBL: ENSMUSP00000090287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092623]
Predicted Effect unknown
Transcript: ENSMUST00000092623
AA Change: R228K
SMART Domains Protein: ENSMUSP00000090287
Gene: ENSMUSG00000019880
AA Change: R228K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FU 35 86 4.74e-6 SMART
FU 92 135 3.79e-5 SMART
EGF 97 126 2.39e1 SMART
TSP1 150 207 1.56e-6 SMART
low complexity region 248 269 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000215256
AA Change: R132K
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the R-spondin family. The encoded protein plays a role in the regulation of Wnt (wingless-type MMTV integration site family)/beta-catenin and Wnt/planar cell polarity (PCP) signaling pathways, which are involved in development, cell growth and disease pathogenesis. Genome-wide association studies suggest a correlation of this gene with bone mineral density and risk of fracture. This gene may be involved in tumor development. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, embryonic growth arrest, and impaired fetal placental vascular development. Mice homozygous for a conditional allele activated in limbs exhibit slight limb shortening. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal A G 2: 121,150,288 E21G probably damaging Het
Ankk1 T C 9: 49,416,346 Y511C probably benign Het
Atn1 G A 6: 124,744,956 probably benign Het
Ccnt2 C A 1: 127,803,241 S618R probably benign Het
Ces4a A G 8: 105,149,378 N517S possibly damaging Het
Chd4 C A 6: 125,109,426 T963K probably damaging Het
Crlf1 A G 8: 70,501,174 Y310C probably damaging Het
Cyyr1 A G 16: 85,457,550 Y155H probably benign Het
Dnah3 A T 7: 120,060,956 I831N probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Echdc1 A G 10: 29,313,715 I17V probably benign Het
Ephx4 G T 5: 107,413,065 V28F probably damaging Het
Erich6 A G 3: 58,616,500 I651T probably damaging Het
Fbln7 A G 2: 128,877,376 Q31R possibly damaging Het
Fbxl17 A G 17: 63,487,788 V433A probably damaging Het
Gm20449 T C 7: 41,458,829 E39G unknown Het
Gprc5b G A 7: 118,984,073 P191L probably benign Het
Klhl1 T C 14: 96,123,222 T731A possibly damaging Het
Myo3b A G 2: 70,232,485 D371G possibly damaging Het
Olfr148 G A 9: 39,614,082 V172M probably damaging Het
P4ha3 G T 7: 100,305,644 C303F probably damaging Het
Parp10 C A 15: 76,240,108 V782L possibly damaging Het
Prpf40a A G 2: 53,151,751 S501P probably damaging Het
Ptpn3 A T 4: 57,265,104 probably null Het
Ptprz1 A C 6: 23,002,501 H1530P probably benign Het
Rasa4 A G 5: 136,103,947 K18E probably damaging Het
Rit1 A G 3: 88,717,638 E48G probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Scai A T 2: 39,075,135 S566T probably benign Het
Scn4a T C 11: 106,328,073 E973G probably benign Het
Slc15a3 T A 19: 10,848,682 F246I possibly damaging Het
Stfa3 T C 16: 36,455,285 D27G possibly damaging Het
Uba5 T C 9: 104,055,221 D181G probably damaging Het
Urb1 T C 16: 90,810,268 T25A probably benign Het
Zbtb43 G T 2: 33,455,054 S16Y probably damaging Het
Zyg11b G A 4: 108,236,089 A717V probably benign Het
Other mutations in Rspo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Rspo3 APN 10 29454152 critical splice donor site probably benign
IGL01726:Rspo3 APN 10 29504708 missense probably benign 0.40
IGL02030:Rspo3 APN 10 29500048 missense probably damaging 1.00
IGL02166:Rspo3 APN 10 29535279 missense possibly damaging 0.86
IGL03078:Rspo3 APN 10 29504661 missense probably damaging 1.00
IGL03412:Rspo3 APN 10 29535274 missense possibly damaging 0.61
R0619:Rspo3 UTSW 10 29504637 missense probably damaging 0.97
R0762:Rspo3 UTSW 10 29499921 splice site probably benign
R0831:Rspo3 UTSW 10 29454257 missense unknown
R4937:Rspo3 UTSW 10 29506528 missense probably damaging 1.00
R5031:Rspo3 UTSW 10 29506447 missense probably damaging 1.00
R5356:Rspo3 UTSW 10 29500068 nonsense probably null
R6285:Rspo3 UTSW 10 29499930 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTTGAGATAGCAGCATCATG -3'
(R):5'- TGGTTTAACAAAAGCAGCTGAGTG -3'

Sequencing Primer
(F):5'- TGAGTCTACAGTAACCTCGCAGG -3'
(R):5'- AGCATGTTAAAATAACCAAGG -3'
Posted On2018-06-22