Incidental Mutation 'R6640:Pigm'
ID525700
Institutional Source Beutler Lab
Gene Symbol Pigm
Ensembl Gene ENSMUSG00000050229
Gene Namephosphatidylinositol glycan anchor biosynthesis, class M
SynonymsC920011G20Rik, 4933437L05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location172376546-172384099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172377687 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 330 (V330A)
Ref Sequence ENSEMBL: ENSMUSP00000052838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052455] [ENSMUST00000056136]
Predicted Effect probably damaging
Transcript: ENSMUST00000052455
AA Change: V330A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052838
Gene: ENSMUSG00000050229
AA Change: V330A

DomainStartEndE-ValueType
Pfam:PIG-U 24 411 7.4e-18 PFAM
Pfam:Mannosyl_trans 140 408 9.8e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056136
SMART Domains Protein: ENSMUSP00000054356
Gene: ENSMUSG00000044708

DomainStartEndE-ValueType
Pfam:IRK 31 363 2.2e-136 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI)-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a mannosyltransferase, GPI-MT-I, that transfers the first mannose to GPI on the lumenal side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Pigm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Pigm APN 1 172377203 missense probably damaging 0.99
IGL02055:Pigm APN 1 172377165 missense probably benign
IGL02129:Pigm APN 1 172377867 nonsense probably null
IGL02888:Pigm APN 1 172377647 missense probably damaging 1.00
IGL03280:Pigm APN 1 172376853 missense probably damaging 1.00
R0725:Pigm UTSW 1 172376817 missense probably damaging 1.00
R1371:Pigm UTSW 1 172376814 missense probably damaging 1.00
R1691:Pigm UTSW 1 172376787 missense probably benign 0.30
R1991:Pigm UTSW 1 172377261 missense probably damaging 1.00
R2089:Pigm UTSW 1 172377533 missense probably damaging 1.00
R2091:Pigm UTSW 1 172377533 missense probably damaging 1.00
R2091:Pigm UTSW 1 172377533 missense probably damaging 1.00
R5718:Pigm UTSW 1 172377445 splice site probably null
R7070:Pigm UTSW 1 172377666 missense probably damaging 0.98
R8273:Pigm UTSW 1 172377957 missense probably benign 0.27
X0003:Pigm UTSW 1 172376736 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTAACTAGGAGGGATATCCGC -3'
(R):5'- AGGCGGTCCTCCTTGTAATG -3'

Sequencing Primer
(F):5'- GAGGGATATCCGCCATAATTTCTC -3'
(R):5'- GGTCCTCCTTGTAATGGGAAATAATC -3'
Posted On2018-06-22