Incidental Mutation 'R6640:Sp3'
ID525703
Institutional Source Beutler Lab
Gene Symbol Sp3
Ensembl Gene ENSMUSG00000027109
Gene Nametrans-acting transcription factor 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location72936427-72980446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72971114 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 185 (L185P)
Ref Sequence ENSEMBL: ENSMUSP00000065807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066003] [ENSMUST00000102689] [ENSMUST00000112062]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066003
AA Change: L185P

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065807
Gene: ENSMUSG00000027109
AA Change: L185P

DomainStartEndE-ValueType
low complexity region 14 59 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
low complexity region 231 241 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 425 448 N/A INTRINSIC
ZnF_C2H2 579 603 1.86e0 SMART
ZnF_C2H2 609 633 7.37e-4 SMART
ZnF_C2H2 639 661 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102689
AA Change: L229P

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099750
Gene: ENSMUSG00000027109
AA Change: L229P

DomainStartEndE-ValueType
low complexity region 20 51 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
low complexity region 469 492 N/A INTRINSIC
ZnF_C2H2 623 647 1.86e0 SMART
ZnF_C2H2 653 677 7.37e-4 SMART
ZnF_C2H2 683 705 5.99e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141372
Meta Mutation Damage Score 0.0909 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: This gene product belongs to a family of Sp1 related transcription factors, which regulate transcription by binding to consensus GC- and GT-box regulatory elements in target genes. This protein contains a zinc finger DNA-binding domain and several transactivation domains, and has been reported to function as a bifunctional transcription factor that either stimulates or represses transcription of numerous genes. Alternative splicing results in transcript variants encoding different isoforms, and one variant initiates translation from a non-AUG (AUA) codon. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit a reduced birth body size, skeletal, tooth and hematopoietic defects, and die shortly after birth due to respiratory failure. Homozygous mutant mice bearing a subtle point mutation in the SUMO attachment site show loss of DNAmethylation in sumoylation-deficient MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Sp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Sp3 APN 2 72938062 utr 3 prime probably benign
IGL02457:Sp3 APN 2 72971469 missense probably damaging 1.00
R0417:Sp3 UTSW 2 72971501 missense possibly damaging 0.57
R0539:Sp3 UTSW 2 72970532 missense possibly damaging 0.90
R0685:Sp3 UTSW 2 72970998 missense probably damaging 1.00
R1435:Sp3 UTSW 2 72938156 missense possibly damaging 0.86
R1731:Sp3 UTSW 2 72946655 missense probably damaging 0.98
R1838:Sp3 UTSW 2 72938176 missense possibly damaging 0.66
R2283:Sp3 UTSW 2 72971177 missense possibly damaging 0.95
R3892:Sp3 UTSW 2 72979032 intron probably benign
R4508:Sp3 UTSW 2 72970397 missense probably damaging 1.00
R4668:Sp3 UTSW 2 72970981 missense probably damaging 1.00
R4896:Sp3 UTSW 2 72938289 missense probably benign 0.18
R5004:Sp3 UTSW 2 72938289 missense probably benign 0.18
R5381:Sp3 UTSW 2 72970566 missense probably benign 0.17
R5493:Sp3 UTSW 2 72938122 missense probably damaging 1.00
R5691:Sp3 UTSW 2 72971459 missense probably damaging 1.00
R5755:Sp3 UTSW 2 72938381 splice site silent
R6364:Sp3 UTSW 2 72970941 missense probably benign 0.00
R7197:Sp3 UTSW 2 72979609 missense probably benign 0.08
R7699:Sp3 UTSW 2 72971229 missense probably benign
R8004:Sp3 UTSW 2 72970208 missense possibly damaging 0.52
R8503:Sp3 UTSW 2 72938301 missense probably benign 0.05
Z1176:Sp3 UTSW 2 72970167 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AGTCATTGTCTGAGAACTTCCCG -3'
(R):5'- TGCACCAGGATCAGATTCATC -3'

Sequencing Primer
(F):5'- ATTGTCTGAGAACTTCCCGAGAGTC -3'
(R):5'- GCACAGTGTCCAATGTTCAG -3'
Posted On2018-06-22