Incidental Mutation 'R6606:Scn4a'
ID525705
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6606 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106328073 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 973 (E973G)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably benign
Transcript: ENSMUST00000021056
AA Change: E973G

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: E973G

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal A G 2: 121,150,288 E21G probably damaging Het
Ankk1 T C 9: 49,416,346 Y511C probably benign Het
Atn1 G A 6: 124,744,956 probably benign Het
Ccnt2 C A 1: 127,803,241 S618R probably benign Het
Ces4a A G 8: 105,149,378 N517S possibly damaging Het
Chd4 C A 6: 125,109,426 T963K probably damaging Het
Crlf1 A G 8: 70,501,174 Y310C probably damaging Het
Cyyr1 A G 16: 85,457,550 Y155H probably benign Het
Dnah3 A T 7: 120,060,956 I831N probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Echdc1 A G 10: 29,313,715 I17V probably benign Het
Ephx4 G T 5: 107,413,065 V28F probably damaging Het
Erich6 A G 3: 58,616,500 I651T probably damaging Het
Fbln7 A G 2: 128,877,376 Q31R possibly damaging Het
Fbxl17 A G 17: 63,487,788 V433A probably damaging Het
Gm20449 T C 7: 41,458,829 E39G unknown Het
Gprc5b G A 7: 118,984,073 P191L probably benign Het
Klhl1 T C 14: 96,123,222 T731A possibly damaging Het
Myo3b A G 2: 70,232,485 D371G possibly damaging Het
Olfr148 G A 9: 39,614,082 V172M probably damaging Het
P4ha3 G T 7: 100,305,644 C303F probably damaging Het
Parp10 C A 15: 76,240,108 V782L possibly damaging Het
Prpf40a A G 2: 53,151,751 S501P probably damaging Het
Ptpn3 A T 4: 57,265,104 probably null Het
Ptprz1 A C 6: 23,002,501 H1530P probably benign Het
Rasa4 A G 5: 136,103,947 K18E probably damaging Het
Rit1 A G 3: 88,717,638 E48G probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rspo3 C T 10: 29,454,281 R228K unknown Het
Scai A T 2: 39,075,135 S566T probably benign Het
Slc15a3 T A 19: 10,848,682 F246I possibly damaging Het
Stfa3 T C 16: 36,455,285 D27G possibly damaging Het
Uba5 T C 9: 104,055,221 D181G probably damaging Het
Urb1 T C 16: 90,810,268 T25A probably benign Het
Zbtb43 G T 2: 33,455,054 S16Y probably damaging Het
Zyg11b G A 4: 108,236,089 A717V probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCACAAGGAGGCTCAGGAC -3'
(R):5'- GATGAGTGGCTCCTGCTCTATTC -3'

Sequencing Primer
(F):5'- GCCTAGGCTCTTTGGTAAAATGCC -3'
(R):5'- GAGTGGCTCCTGCTCTATTCTCTTC -3'
Posted On2018-06-22