Incidental Mutation 'R6640:Aldh1b1'
ID525708
Institutional Source Beutler Lab
Gene Symbol Aldh1b1
Ensembl Gene ENSMUSG00000035561
Gene Namealdehyde dehydrogenase 1 family, member B1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45799022-45804604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45803868 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 469 (T469A)
Ref Sequence ENSEMBL: ENSMUSP00000041260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044384] [ENSMUST00000172750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044384
AA Change: T469A

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041260
Gene: ENSMUSG00000035561
AA Change: T469A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 510 1.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172750
SMART Domains Protein: ENSMUSP00000134082
Gene: ENSMUSG00000035561

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 132 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. This gene does not contain introns in the coding sequence. The variation of this locus may affect the development of alcohol-related problems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased fasting circulating glucose levels and decreased blood acetaldehyde clearance. Mice homozygous for a different knock-out allele display defects in beta cell development and functionality, and develop glucose intolerance, age-dependent hyperglycemia, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Aldh1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Aldh1b1 APN 4 45803472 missense possibly damaging 0.87
R0557:Aldh1b1 UTSW 4 45802647 missense probably benign 0.00
R1203:Aldh1b1 UTSW 4 45803359 missense probably damaging 1.00
R1807:Aldh1b1 UTSW 4 45802873 missense possibly damaging 0.69
R1939:Aldh1b1 UTSW 4 45802755 missense possibly damaging 0.53
R4722:Aldh1b1 UTSW 4 45803472 missense probably damaging 1.00
R4847:Aldh1b1 UTSW 4 45802625 missense possibly damaging 0.92
R4871:Aldh1b1 UTSW 4 45803383 missense probably benign 0.00
R4931:Aldh1b1 UTSW 4 45803661 missense probably benign 0.08
R4994:Aldh1b1 UTSW 4 45803128 missense possibly damaging 0.90
R5071:Aldh1b1 UTSW 4 45803383 splice site probably null
R5216:Aldh1b1 UTSW 4 45803652 missense probably damaging 1.00
R5582:Aldh1b1 UTSW 4 45802750 missense probably damaging 1.00
R6077:Aldh1b1 UTSW 4 45802525 missense possibly damaging 0.92
R6692:Aldh1b1 UTSW 4 45803427 missense probably damaging 1.00
R7055:Aldh1b1 UTSW 4 45802909 missense possibly damaging 0.84
R7935:Aldh1b1 UTSW 4 45802968 missense probably benign 0.13
R7949:Aldh1b1 UTSW 4 45802807 missense possibly damaging 0.53
R7976:Aldh1b1 UTSW 4 45803092 missense possibly damaging 0.92
R8441:Aldh1b1 UTSW 4 45802465 start codon destroyed probably null
R8515:Aldh1b1 UTSW 4 45803818 missense probably damaging 1.00
Z1088:Aldh1b1 UTSW 4 45802539 missense probably benign 0.06
Z1088:Aldh1b1 UTSW 4 45802540 missense probably benign 0.11
Z1177:Aldh1b1 UTSW 4 45802692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCATGAGGATCGCCAAG -3'
(R):5'- CTGAAATCAGATTTTGCCCTCC -3'

Sequencing Primer
(F):5'- TCGCCAAGGAGGAGATCTTTG -3'
(R):5'- TCCACTGGCTAGATGTCACG -3'
Posted On2018-06-22