Incidental Mutation 'R6640:Ccdc136'
ID525712
Institutional Source Beutler Lab
Gene Symbol Ccdc136
Ensembl Gene ENSMUSG00000029769
Gene Namecoiled-coil domain containing 136
Synonyms4921511K06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29396309-29426994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29412960 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 382 (D382G)
Ref Sequence ENSEMBL: ENSMUSP00000118132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096084] [ENSMUST00000115275] [ENSMUST00000145310] [ENSMUST00000154619] [ENSMUST00000180829] [ENSMUST00000181464] [ENSMUST00000202726]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096084
AA Change: D540G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093789
Gene: ENSMUSG00000029769
AA Change: D540G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 7.26e-6 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 8.87e-9 PROSPERO
internal_repeat_1 819 838 8.87e-9 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 7.26e-6 PROSPERO
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
coiled coil region 1066 1104 N/A INTRINSIC
low complexity region 1108 1142 N/A INTRINSIC
transmembrane domain 1154 1176 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115275
AA Change: D540G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110930
Gene: ENSMUSG00000029769
AA Change: D540G

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
internal_repeat_2 416 435 1.72e-5 PROSPERO
low complexity region 439 453 N/A INTRINSIC
coiled coil region 463 489 N/A INTRINSIC
coiled coil region 526 611 N/A INTRINSIC
low complexity region 645 658 N/A INTRINSIC
coiled coil region 730 779 N/A INTRINSIC
internal_repeat_1 791 810 2.93e-8 PROSPERO
internal_repeat_1 819 838 2.93e-8 PROSPERO
low complexity region 847 868 N/A INTRINSIC
internal_repeat_2 902 921 1.72e-5 PROSPERO
transmembrane domain 967 989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143599
Predicted Effect probably benign
Transcript: ENSMUST00000145310
SMART Domains Protein: ENSMUSP00000145331
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
low complexity region 85 92 N/A INTRINSIC
coiled coil region 99 310 N/A INTRINSIC
coiled coil region 343 408 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154619
AA Change: D382G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118132
Gene: ENSMUSG00000029769
AA Change: D382G

DomainStartEndE-ValueType
coiled coil region 1 152 N/A INTRINSIC
coiled coil region 185 250 N/A INTRINSIC
internal_repeat_2 258 277 4.68e-6 PROSPERO
low complexity region 281 295 N/A INTRINSIC
coiled coil region 305 331 N/A INTRINSIC
coiled coil region 368 453 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
coiled coil region 572 621 N/A INTRINSIC
internal_repeat_1 633 652 5.47e-9 PROSPERO
internal_repeat_1 661 680 5.47e-9 PROSPERO
low complexity region 689 710 N/A INTRINSIC
internal_repeat_2 744 763 4.68e-6 PROSPERO
low complexity region 836 853 N/A INTRINSIC
low complexity region 865 883 N/A INTRINSIC
coiled coil region 908 946 N/A INTRINSIC
low complexity region 950 984 N/A INTRINSIC
transmembrane domain 996 1018 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180829
AA Change: D448G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137747
Gene: ENSMUSG00000029769
AA Change: D448G

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 1.21e-5 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.98e-8 PROSPERO
internal_repeat_1 727 746 1.98e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 1.21e-5 PROSPERO
transmembrane domain 875 897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000181464
AA Change: D448G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137673
Gene: ENSMUSG00000029769
AA Change: D448G

DomainStartEndE-ValueType
coiled coil region 7 218 N/A INTRINSIC
coiled coil region 251 316 N/A INTRINSIC
internal_repeat_2 324 343 7.68e-6 PROSPERO
low complexity region 347 361 N/A INTRINSIC
coiled coil region 371 397 N/A INTRINSIC
coiled coil region 434 519 N/A INTRINSIC
low complexity region 553 566 N/A INTRINSIC
coiled coil region 638 687 N/A INTRINSIC
internal_repeat_1 699 718 1.04e-8 PROSPERO
internal_repeat_1 727 746 1.04e-8 PROSPERO
low complexity region 755 776 N/A INTRINSIC
internal_repeat_2 810 829 7.68e-6 PROSPERO
low complexity region 902 919 N/A INTRINSIC
low complexity region 931 949 N/A INTRINSIC
transmembrane domain 969 991 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202726
SMART Domains Protein: ENSMUSP00000144577
Gene: ENSMUSG00000029769

DomainStartEndE-ValueType
coiled coil region 25 90 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Ccdc136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ccdc136 APN 6 29420258 missense probably damaging 0.96
IGL01325:Ccdc136 APN 6 29412950 missense probably benign 0.00
IGL01608:Ccdc136 APN 6 29406114 missense possibly damaging 0.90
IGL02305:Ccdc136 APN 6 29406174 missense probably damaging 1.00
IGL03354:Ccdc136 APN 6 29419103 missense probably damaging 1.00
dimensionless UTSW 6 29412450 missense probably benign 0.03
punctate UTSW 6 29410205 missense probably damaging 0.99
PIT4515001:Ccdc136 UTSW 6 29417226 missense probably benign 0.42
R0436:Ccdc136 UTSW 6 29414934 missense probably damaging 1.00
R0709:Ccdc136 UTSW 6 29414970 missense possibly damaging 0.64
R1451:Ccdc136 UTSW 6 29419377 missense probably benign 0.09
R1593:Ccdc136 UTSW 6 29415584 missense probably damaging 1.00
R1966:Ccdc136 UTSW 6 29418092 missense probably damaging 1.00
R2113:Ccdc136 UTSW 6 29413032 missense possibly damaging 0.51
R3845:Ccdc136 UTSW 6 29417177 missense probably benign 0.20
R4668:Ccdc136 UTSW 6 29411281 missense probably damaging 0.99
R5037:Ccdc136 UTSW 6 29417123 missense probably damaging 1.00
R5085:Ccdc136 UTSW 6 29419314 missense probably damaging 1.00
R5314:Ccdc136 UTSW 6 29417498 missense probably benign 0.07
R5340:Ccdc136 UTSW 6 29411860 missense possibly damaging 0.84
R5702:Ccdc136 UTSW 6 29412982 missense probably damaging 0.99
R6108:Ccdc136 UTSW 6 29412450 missense probably benign 0.03
R6313:Ccdc136 UTSW 6 29410205 missense probably damaging 0.99
R6765:Ccdc136 UTSW 6 29405941 missense probably benign
R7910:Ccdc136 UTSW 6 29420034 missense probably benign 0.08
R7914:Ccdc136 UTSW 6 29419307 missense probably damaging 1.00
R8030:Ccdc136 UTSW 6 29417142 missense probably benign 0.07
R8414:Ccdc136 UTSW 6 29412930 missense probably damaging 1.00
X0025:Ccdc136 UTSW 6 29409243 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGCCTGTTAAGGATAGGTCTG -3'
(R):5'- TTCTACCTTCAGTTGGGCGAC -3'

Sequencing Primer
(F):5'- AAGGATAGGTCTGTTTGGTTCTCCC -3'
(R):5'- GGCGACCTTGTCTGCTTC -3'
Posted On2018-06-22