Incidental Mutation 'R6640:Olfr695'
ID525722
Institutional Source Beutler Lab
Gene Symbol Olfr695
Ensembl Gene ENSMUSG00000108948
Gene Nameolfactory receptor 695
SynonymsGA_x6K02T2PBJ9-9092181-9091234, MOR283-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location106711031-106716396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106714040 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 214 (I214F)
Ref Sequence ENSEMBL: ENSMUSP00000149773 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000216868
AA Change: I214F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Olfr695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Olfr695 APN 7 106874253 utr 5 prime probably benign
IGL02143:Olfr695 APN 7 106873973 missense probably benign 0.02
R0492:Olfr695 UTSW 7 106873877 missense probably damaging 1.00
R1816:Olfr695 UTSW 7 106873488 nonsense probably null
R1834:Olfr695 UTSW 7 106874141 missense probably damaging 1.00
R2011:Olfr695 UTSW 7 106873427 missense probably benign 0.03
R3434:Olfr695 UTSW 7 106873769 missense probably benign 0.01
R3842:Olfr695 UTSW 7 106874095 missense probably benign 0.07
R4405:Olfr695 UTSW 7 106873373 missense probably damaging 1.00
R4742:Olfr695 UTSW 7 106873428 missense probably damaging 0.99
R4815:Olfr695 UTSW 7 106874237 missense probably benign
R4851:Olfr695 UTSW 7 106874014 missense probably damaging 1.00
R4856:Olfr695 UTSW 7 106873970 missense probably damaging 1.00
R5663:Olfr695 UTSW 7 106873670 missense probably benign 0.43
R5783:Olfr695 UTSW 7 106873334 missense probably damaging 0.97
R6552:Olfr695 UTSW 7 106714643 small deletion probably benign
R6798:Olfr695 UTSW 7 106714195 missense probably damaging 1.00
R7365:Olfr695 UTSW 7 106713964 missense probably benign 0.03
R7496:Olfr695 UTSW 7 106714228 missense probably benign 0.23
R7923:Olfr695 UTSW 7 106714442 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAGAGCTGGAGTGACAATCATG -3'
(R):5'- GCATCTCTCAGTGCTCTAGG -3'

Sequencing Primer
(F):5'- TGACAATCATGTAGAAAACTGAGCTG -3'
(R):5'- GCATCTCTCAGTGCTCTAGGATATAG -3'
Posted On2018-06-22