Incidental Mutation 'R6607:Ctbs'
ID525729
Institutional Source Beutler Lab
Gene Symbol Ctbs
Ensembl Gene ENSMUSG00000028189
Gene Namechitobiase, di-N-acetyl-
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146449795-146465849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146457373 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 172 (D172G)
Ref Sequence ENSEMBL: ENSMUSP00000059167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029839] [ENSMUST00000029840] [ENSMUST00000061937] [ENSMUST00000196609] [ENSMUST00000197980]
Predicted Effect probably benign
Transcript: ENSMUST00000029839
SMART Domains Protein: ENSMUSP00000029839
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:SPATA1_C 279 428 1.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000029840
AA Change: D172G

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029840
Gene: ENSMUSG00000028189
AA Change: D172G

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:Glyco_hydro_18 79 257 1.6e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000061937
AA Change: D172G

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059167
Gene: ENSMUSG00000028189
AA Change: D172G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Glyco_18 45 343 2.62e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196609
SMART Domains Protein: ENSMUSP00000142380
Gene: ENSMUSG00000028189

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197166
Predicted Effect probably benign
Transcript: ENSMUST00000197980
SMART Domains Protein: ENSMUSP00000142800
Gene: ENSMUSG00000028188

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
SCOP:d1eq1a_ 267 365 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200488
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chitobiase is a lysosomal glycosidase involved in degradation of asparagine-linked oligosaccharides on glycoproteins (Aronson and Kuranda, 1989 [PubMed 2531691]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of oligosaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Ctbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Ctbs APN 3 146455112 missense probably benign 0.02
R0133:Ctbs UTSW 3 146457468 missense probably benign 0.01
R0845:Ctbs UTSW 3 146455107 missense probably damaging 1.00
R1512:Ctbs UTSW 3 146454965 missense probably benign 0.00
R1523:Ctbs UTSW 3 146454980 missense probably benign 0.01
R4194:Ctbs UTSW 3 146450613 missense probably benign 0.00
R6739:Ctbs UTSW 3 146459499 splice site probably null
R7021:Ctbs UTSW 3 146454948 missense probably damaging 1.00
R7361:Ctbs UTSW 3 146458754 missense probably damaging 1.00
R7446:Ctbs UTSW 3 146458818 missense probably damaging 1.00
R8515:Ctbs UTSW 3 146458813 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAGTTATAGACACAGGCCAG -3'
(R):5'- CACCTTAGTGCCTGAGGTTTTG -3'

Sequencing Primer
(F):5'- GTTATAGACACAGGCCAGTCCAATG -3'
(R):5'- GGCTGCAATACATTCTGAC -3'
Posted On2018-06-22