Incidental Mutation 'R6607:Hamp2'
ID525737
Institutional Source Beutler Lab
Gene Symbol Hamp2
Ensembl Gene ENSMUSG00000056978
Gene Namehepcidin antimicrobial peptide 2
SynonymsHEPC2, 1810073K19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30922372-30924681 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 30922588 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 59 (R59*)
Ref Sequence ENSEMBL: ENSMUSP00000151677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074671] [ENSMUST00000217812]
Predicted Effect probably null
Transcript: ENSMUST00000074671
AA Change: R58*
SMART Domains Protein: ENSMUSP00000074240
Gene: ENSMUSG00000056978
AA Change: R58*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Hepcidin 33 84 9.9e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205641
AA Change: R77*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206970
Predicted Effect probably null
Transcript: ENSMUST00000217812
AA Change: R59*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: This gene encodes a peptide hormone that functions in the regulation of systemic iron metabolism. The encoded preproprotein is synthesized in the hepatocytes where it undergoes proteolytic processing to generate disulfide-linked mature peptides that are secreted into the bloodstream. Transgenic mice overexpressing the encoded protein develop normally with hematologic parameters similar to the non-transgenic mice. This gene is located adjacent to a related hepcidin gene on chromosome 7. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Hamp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02149:Hamp2 APN 7 30922697 missense probably damaging 0.96
R0571:Hamp2 UTSW 7 30924086 missense possibly damaging 0.96
R3608:Hamp2 UTSW 7 30924114 missense probably benign 0.06
R7393:Hamp2 UTSW 7 30922605 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TATTTCAAGGTCATTGCTGGAGAGG -3'
(R):5'- AAAGTCAGGAAGCTATGCCG -3'

Sequencing Primer
(F):5'- TCATTGCTGGAGAGGGCAGG -3'
(R):5'- CTTCTGCTTTCACAGATGAGACAGAC -3'
Posted On2018-06-22