Mutagenetix > Incidental Mutation

Incidental Mutation 'R6640:Sh3rf2'

525750

Institutional Source

Beutler Lab

Gene Symbol

Sh3rf2

Ensembl Gene

ENSMUSG00000057719

Gene Name

SH3 domain containing ring finger 2

Synonyms

9130023G24Rik, RNF158

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42053667-42158960 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42101640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 163 (Y163N)

Ref Sequence

ENSEMBL: ENSMUSP00000074247 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072008] [ENSMUST00000074679]

AlphaFold

Q8BZT2

Predicted Effect

probably damaging
Transcript: ENSMUST00000072008
AA Change: Y163N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000071896
Gene: ENSMUSG00000057719
AA Change: Y163N

Domain	Start	End	E-Value	Type
RING	12	52	7.38e-8	SMART
low complexity region	63	73	N/A	INTRINSIC
SH3	128	183	4.66e-17	SMART
SH3	190	251	1.45e-13	SMART
low complexity region	357	366	N/A	INTRINSIC
SH3	385	442	3.27e-12	SMART
low complexity region	500	514	N/A	INTRINSIC
low complexity region	614	631	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074679
AA Change: Y163N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000074247
Gene: ENSMUSG00000057719
AA Change: Y163N

Domain	Start	End	E-Value	Type
RING	12	52	7.38e-8	SMART
low complexity region	63	73	N/A	INTRINSIC
SH3	128	183	4.66e-17	SMART
low complexity region	325	334	N/A	INTRINSIC
SH3	353	410	3.27e-12	SMART
low complexity region	468	482	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

97% (31/32)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,553,285	N936K	probably benign	Het
Abca2	A	T	2: 25,447,003	Y2318F	possibly damaging	Het
Aldh1b1	A	G	4: 45,803,868	T469A	possibly damaging	Het
Ccdc136	A	G	6: 29,412,960	D382G	possibly damaging	Het
Dapk1	A	G	13: 60,716,814	K141E	probably damaging	Het
Dnah6	A	T	6: 73,024,293	W3973R	probably damaging	Het
Dock10	G	T	1: 80,533,838	S1518*	probably null	Het
Doxl2	A	G	6: 48,977,671	D581G	probably benign	Het
Elovl5	C	A	9: 77,979,913	Y195*	probably null	Het
Fbxl21	T	A	13: 56,537,009	W309R	probably damaging	Het
Gm10020	G	T	15: 52,477,620		noncoding transcript	Het
Gm10801	C	CGTG	2: 98,663,807		probably null	Het
Gpx1	A	G	9: 108,340,096	D133G	probably damaging	Het
Hoxd1	T	A	2: 74,763,262	V54E	probably damaging	Het
Kcnh3	T	C	15: 99,241,768	V876A	probably benign	Het
Klri2	G	C	6: 129,732,195	F231L	probably benign	Het
Mogat1	T	G	1: 78,523,774	S158R	probably damaging	Het
Myo1c	C	T	11: 75,671,635	P918S	probably benign	Het
Olfr1008	T	A	2: 85,689,935	C169S	probably damaging	Het
Olfr695	T	A	7: 106,714,040	I214F	probably damaging	Het
Otog	G	A	7: 46,261,743	A673T	possibly damaging	Het
Pigm	T	C	1: 172,377,687	V330A	probably damaging	Het
Rab33b	A	G	3: 51,484,479	T50A	possibly damaging	Het
Raver2	C	T	4: 101,131,303	P371L	probably damaging	Het
Slc1a1	T	C	19: 28,894,570		probably null	Het
Slc6a18	T	A	13: 73,664,282	Y563F	possibly damaging	Het
Sp3	A	G	2: 72,971,114	L185P	possibly damaging	Het
Thbs2	T	C	17: 14,673,368	D850G	possibly damaging	Het
Tmem161b	C	A	13: 84,222,418		probably benign	Het
Tmtc2	T	A	10: 105,573,749	M1L	probably benign	Het
Trpm2	C	T	10: 77,937,826	R585Q	probably benign	Het
Trpm3	T	A	19: 22,978,582	I1126K	probably damaging	Het
Ugt1a6b	A	C	1: 88,107,794	T285P	probably benign	Het
Vps13b	A	G	15: 35,617,696	T1181A	possibly damaging	Het

Other mutations in Sh3rf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Sh3rf2	APN	18	42111218	missense	probably benign	0.00
IGL01012:Sh3rf2	APN	18	42054192	missense	possibly damaging	0.50
IGL01286:Sh3rf2	APN	18	42139611	critical splice donor site	probably null
IGL02369:Sh3rf2	APN	18	42156157	nonsense	probably null
IGL02563:Sh3rf2	APN	18	42156142	missense	probably damaging	0.99
BB004:Sh3rf2	UTSW	18	42111422	missense	probably benign
BB014:Sh3rf2	UTSW	18	42111422	missense	probably benign
PIT4445001:Sh3rf2	UTSW	18	42153164	missense	probably benign	0.00
R0141:Sh3rf2	UTSW	18	42156057	missense	probably benign	0.02
R0270:Sh3rf2	UTSW	18	42104081	missense	probably damaging	0.99
R1447:Sh3rf2	UTSW	18	42101671	missense	probably benign	0.00
R1491:Sh3rf2	UTSW	18	42053939	missense	probably damaging	0.99
R1539:Sh3rf2	UTSW	18	42149822	missense	probably damaging	1.00
R1595:Sh3rf2	UTSW	18	42111288	missense	probably damaging	1.00
R1749:Sh3rf2	UTSW	18	42153294	missense	probably damaging	1.00
R1864:Sh3rf2	UTSW	18	42053981	missense	probably damaging	0.99
R1942:Sh3rf2	UTSW	18	42149624	missense	probably damaging	1.00
R1998:Sh3rf2	UTSW	18	42141083	missense	probably damaging	0.99
R2331:Sh3rf2	UTSW	18	42053863	missense	probably benign	0.04
R2680:Sh3rf2	UTSW	18	42101650	missense	probably damaging	0.98
R2938:Sh3rf2	UTSW	18	42149724	missense	probably benign	0.09
R2940:Sh3rf2	UTSW	18	42111440	critical splice donor site	probably null
R3753:Sh3rf2	UTSW	18	42111308	missense	probably damaging	1.00
R3861:Sh3rf2	UTSW	18	42153319	missense	probably damaging	1.00
R4322:Sh3rf2	UTSW	18	42111399	missense	probably damaging	1.00
R5076:Sh3rf2	UTSW	18	42053924	missense	probably damaging	1.00
R5169:Sh3rf2	UTSW	18	42153061	missense	probably benign	0.00
R5228:Sh3rf2	UTSW	18	42153181	missense	possibly damaging	0.69
R5437:Sh3rf2	UTSW	18	42141014	missense	probably benign	0.44
R5792:Sh3rf2	UTSW	18	42111138	missense	probably damaging	0.99
R5820:Sh3rf2	UTSW	18	42141047	missense	possibly damaging	0.94
R6159:Sh3rf2	UTSW	18	42156135	missense	probably damaging	0.96
R6366:Sh3rf2	UTSW	18	42153065	missense	probably benign	0.00
R6897:Sh3rf2	UTSW	18	42101605	missense	possibly damaging	0.91
R6995:Sh3rf2	UTSW	18	42101541	missense	probably damaging	1.00
R7097:Sh3rf2	UTSW	18	42104162	splice site	probably null
R7122:Sh3rf2	UTSW	18	42104162	splice site	probably null
R7432:Sh3rf2	UTSW	18	42054026	missense	probably damaging	0.99
R7444:Sh3rf2	UTSW	18	42101539	missense	probably damaging	1.00
R7654:Sh3rf2	UTSW	18	42104108	missense	probably damaging	1.00
R7703:Sh3rf2	UTSW	18	42156136	missense	probably benign	0.04
R7732:Sh3rf2	UTSW	18	42101688	missense	probably damaging	1.00
R7835:Sh3rf2	UTSW	18	42111170	missense	probably benign	0.25
R7927:Sh3rf2	UTSW	18	42111422	missense	probably benign
R8053:Sh3rf2	UTSW	18	42153022	missense	probably damaging	1.00
R8144:Sh3rf2	UTSW	18	42141059	missense	probably benign	0.01
R8343:Sh3rf2	UTSW	18	42111428	missense	probably damaging	0.99
R9145:Sh3rf2	UTSW	18	42149681	missense
R9328:Sh3rf2	UTSW	18	42141096	missense	probably benign	0.08
R9570:Sh3rf2	UTSW	18	42139555	missense	possibly damaging	0.75
R9668:Sh3rf2	UTSW	18	42111282	missense	probably benign	0.31
R9676:Sh3rf2	UTSW	18	42149795	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGTATGAGACATTCCATTCTTCCAC -3'
(R):5'- GCAAGTATTAAACAATGGACTCTGG -3'

Sequencing Primer
(F):5'- GACATTCCATTCTTCCACCCCTAATC -3'
(R):5'- AAACAATGGACTCTGGGTTCTGC -3'

Posted On

2018-06-22