Mutagenetix > Incidental Mutations

Incidental Mutation 'R6607:Vmn2r84'

525751

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r84

Ensembl Gene

ENSMUSG00000070601

Gene Name

vomeronasal 2, receptor 84

Synonyms

EG625068

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6607 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

130385316-130394241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130390862 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 369 (H369R)

Ref Sequence

ENSEMBL: ENSMUSP00000092079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094502]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094502
AA Change: H369R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: H369R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	77	448	1.3e-27	PFAM
Pfam:NCD3G	508	561	6.9e-21	PFAM
Pfam:7tm_3	594	830	4.6e-55	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.8%

Validation Efficiency

96% (27/28)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	T	C	15: 83,228,306	D92G	possibly damaging	Het
Ace	A	T	11: 105,972,377	H326L	possibly damaging	Het
Adtrp	A	G	13: 41,777,611	F167L	probably benign	Het
Agbl2	A	G	2: 90,801,326	T343A	probably damaging	Het
Cacna1a	A	T	8: 84,579,492	I1290F	probably damaging	Het
Cdh4	G	A	2: 179,874,096	V356I	probably benign	Het
Celsr1	A	G	15: 85,963,285	V1417A	probably benign	Het
Ctbs	A	G	3: 146,457,373	D172G	possibly damaging	Het
Dnah5	A	G	15: 28,445,200	T4161A	possibly damaging	Het
Dut	A	G	2: 125,256,867	D140G	probably damaging	Het
Ep400	T	C	5: 110,683,314	D2162G	unknown	Het
Esyt2	G	A	12: 116,368,740	D781N	probably benign	Het
Fam174b	T	C	7: 73,766,564	L135P	probably damaging	Het
Fbxo15	A	T	18: 84,959,145	T106S	possibly damaging	Het
Foxq1	A	G	13: 31,559,146	D77G	possibly damaging	Het
Gclm	G	A	3: 122,255,615		probably null	Het
Gcn1l1	T	A	5: 115,609,478	S1677T	probably damaging	Het
Hamp2	T	A	7: 30,922,588	R59*	probably null	Het
Herc1	C	T	9: 66,418,567	A1441V	probably benign	Het
Lrp1	G	A	10: 127,560,136	H2422Y	probably damaging	Het
Rbks	C	T	5: 31,647,792	V243M	possibly damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rsf1	CG	CGACGGCGGTG	7: 97,579,908		probably benign	Homo
Slc17a4	T	C	13: 23,905,414		probably null	Het
Slc29a1	A	C	17: 45,588,927		probably null	Het
Tenm2	A	G	11: 36,063,775		probably null	Het
Tmem26	T	A	10: 68,778,713	H319Q	probably benign	Het
Vmn1r203	A	G	13: 22,524,721	Y224C	probably benign	Het
Vmn1r223	T	C	13: 23,249,749	I171T	probably damaging	Het
Vmn2r101	T	C	17: 19,612,034	L764S	probably damaging	Het

Other mutations in Vmn2r84

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01461:Vmn2r84	APN	10	130391225	missense	possibly damaging	0.65
IGL01590:Vmn2r84	APN	10	130386095	missense	probably damaging	1.00
IGL01639:Vmn2r84	APN	10	130389272	nonsense	probably null
IGL01843:Vmn2r84	APN	10	130386279	missense	probably benign
IGL01911:Vmn2r84	APN	10	130386408	missense	probably damaging	0.99
IGL01937:Vmn2r84	APN	10	130385886	missense	probably damaging	1.00
IGL01977:Vmn2r84	APN	10	130394066	missense	probably benign	0.11
IGL02177:Vmn2r84	APN	10	130392012	missense	probably benign	0.00
IGL02291:Vmn2r84	APN	10	130390748	missense	probably damaging	1.00
IGL02590:Vmn2r84	APN	10	130391487	splice site	probably benign
IGL02727:Vmn2r84	APN	10	130394126	missense	possibly damaging	0.95
IGL02900:Vmn2r84	APN	10	130387992	splice site	probably benign
IGL03383:Vmn2r84	APN	10	130386687	missense	probably damaging	1.00
PIT4378001:Vmn2r84	UTSW	10	130385915	missense	probably damaging	1.00
R0076:Vmn2r84	UTSW	10	130394193	missense	probably damaging	1.00
R0089:Vmn2r84	UTSW	10	130386719	splice site	probably benign
R0153:Vmn2r84	UTSW	10	130392008	missense	probably benign	0.06
R0611:Vmn2r84	UTSW	10	130386122	missense	probably damaging	1.00
R0883:Vmn2r84	UTSW	10	130391115	missense	probably damaging	0.99
R1237:Vmn2r84	UTSW	10	130387856	splice site	probably null
R1295:Vmn2r84	UTSW	10	130389139	missense	probably benign	0.12
R1401:Vmn2r84	UTSW	10	130391990	missense	possibly damaging	0.89
R1521:Vmn2r84	UTSW	10	130389268	missense	probably benign	0.10
R1590:Vmn2r84	UTSW	10	130391480	critical splice acceptor site	probably null
R1710:Vmn2r84	UTSW	10	130391099	missense	probably benign	0.02
R1891:Vmn2r84	UTSW	10	130386069	missense	possibly damaging	0.78
R1956:Vmn2r84	UTSW	10	130390808	missense	probably benign	0.01
R1957:Vmn2r84	UTSW	10	130390808	missense	probably benign	0.01
R1962:Vmn2r84	UTSW	10	130390722	missense	probably damaging	0.99
R1994:Vmn2r84	UTSW	10	130386009	missense	probably damaging	1.00
R2124:Vmn2r84	UTSW	10	130391231	missense	probably damaging	0.99
R2409:Vmn2r84	UTSW	10	130392071	missense	probably damaging	0.99
R2474:Vmn2r84	UTSW	10	130386523	missense	possibly damaging	0.50
R2851:Vmn2r84	UTSW	10	130394167	missense	probably benign	0.05
R3508:Vmn2r84	UTSW	10	130390908	missense	probably damaging	1.00
R3792:Vmn2r84	UTSW	10	130385800	makesense	probably null
R4051:Vmn2r84	UTSW	10	130390898	missense	probably damaging	1.00
R4061:Vmn2r84	UTSW	10	130386029	missense	probably damaging	1.00
R4091:Vmn2r84	UTSW	10	130391369	missense	probably damaging	1.00
R4190:Vmn2r84	UTSW	10	130391294	nonsense	probably null
R4520:Vmn2r84	UTSW	10	130386522	missense	probably damaging	1.00
R4584:Vmn2r84	UTSW	10	130390713	missense	probably benign	0.00
R4588:Vmn2r84	UTSW	10	130385940	missense	probably damaging	0.98
R4655:Vmn2r84	UTSW	10	130394104	nonsense	probably null
R4860:Vmn2r84	UTSW	10	130385843	missense	probably damaging	0.99
R4860:Vmn2r84	UTSW	10	130385843	missense	probably damaging	0.99
R5022:Vmn2r84	UTSW	10	130386548	missense	probably damaging	1.00
R5146:Vmn2r84	UTSW	10	130386102	missense	probably damaging	1.00
R5237:Vmn2r84	UTSW	10	130385994	missense	probably damaging	0.99
R5695:Vmn2r84	UTSW	10	130389195	missense	probably benign	0.12
R5793:Vmn2r84	UTSW	10	130385885	missense	probably damaging	0.99
R6210:Vmn2r84	UTSW	10	130386245	missense	probably damaging	1.00
R6286:Vmn2r84	UTSW	10	130390868	missense	possibly damaging	0.65
R6580:Vmn2r84	UTSW	10	130389241	missense	possibly damaging	0.93
R6818:Vmn2r84	UTSW	10	130386278	missense	probably benign	0.09
R6956:Vmn2r84	UTSW	10	130389267	missense	probably damaging	0.98
R6994:Vmn2r84	UTSW	10	130391007	missense	possibly damaging	0.90
R7075:Vmn2r84	UTSW	10	130391072	missense	probably damaging	0.99
R7225:Vmn2r84	UTSW	10	130386683	missense	probably damaging	0.99
R7252:Vmn2r84	UTSW	10	130386410	missense	probably damaging	1.00
R7263:Vmn2r84	UTSW	10	130389208	missense	probably damaging	1.00
R7297:Vmn2r84	UTSW	10	130391250	missense	probably benign	0.19
R7439:Vmn2r84	UTSW	10	130392113	missense	possibly damaging	0.90
R7441:Vmn2r84	UTSW	10	130392113	missense	possibly damaging	0.90
R7857:Vmn2r84	UTSW	10	130390869	missense	probably benign	0.00
R7940:Vmn2r84	UTSW	10	130390869	missense	probably benign	0.00
Z1177:Vmn2r84	UTSW	10	130391902	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTACCTGCTGACATTCTGTG -3'
(R):5'- ATCACAACCTCACAATGGGATG -3'

Sequencing Primer
(F):5'- ACCTGCTGACATTCTGTGTATTC -3'
(R):5'- ACCTCACAATGGGATGTTATCAC -3'

Posted On

2018-06-22