Incidental Mutation 'R6607:Vmn2r84'
ID525751
Institutional Source Beutler Lab
Gene Symbol Vmn2r84
Ensembl Gene ENSMUSG00000070601
Gene Namevomeronasal 2, receptor 84
SynonymsEG625068
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130385316-130394241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130390862 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 369 (H369R)
Ref Sequence ENSEMBL: ENSMUSP00000092079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094502]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094502
AA Change: H369R

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: H369R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 77 448 1.3e-27 PFAM
Pfam:NCD3G 508 561 6.9e-21 PFAM
Pfam:7tm_3 594 830 4.6e-55 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Other mutations in Vmn2r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Vmn2r84 APN 10 130391225 missense possibly damaging 0.65
IGL01590:Vmn2r84 APN 10 130386095 missense probably damaging 1.00
IGL01639:Vmn2r84 APN 10 130389272 nonsense probably null
IGL01843:Vmn2r84 APN 10 130386279 missense probably benign
IGL01911:Vmn2r84 APN 10 130386408 missense probably damaging 0.99
IGL01937:Vmn2r84 APN 10 130385886 missense probably damaging 1.00
IGL01977:Vmn2r84 APN 10 130394066 missense probably benign 0.11
IGL02177:Vmn2r84 APN 10 130392012 missense probably benign 0.00
IGL02291:Vmn2r84 APN 10 130390748 missense probably damaging 1.00
IGL02590:Vmn2r84 APN 10 130391487 splice site probably benign
IGL02727:Vmn2r84 APN 10 130394126 missense possibly damaging 0.95
IGL02900:Vmn2r84 APN 10 130387992 splice site probably benign
IGL03383:Vmn2r84 APN 10 130386687 missense probably damaging 1.00
PIT4378001:Vmn2r84 UTSW 10 130385915 missense probably damaging 1.00
R0076:Vmn2r84 UTSW 10 130394193 missense probably damaging 1.00
R0089:Vmn2r84 UTSW 10 130386719 splice site probably benign
R0153:Vmn2r84 UTSW 10 130392008 missense probably benign 0.06
R0611:Vmn2r84 UTSW 10 130386122 missense probably damaging 1.00
R0883:Vmn2r84 UTSW 10 130391115 missense probably damaging 0.99
R1237:Vmn2r84 UTSW 10 130387856 splice site probably null
R1295:Vmn2r84 UTSW 10 130389139 missense probably benign 0.12
R1401:Vmn2r84 UTSW 10 130391990 missense possibly damaging 0.89
R1521:Vmn2r84 UTSW 10 130389268 missense probably benign 0.10
R1590:Vmn2r84 UTSW 10 130391480 critical splice acceptor site probably null
R1710:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R1891:Vmn2r84 UTSW 10 130386069 missense possibly damaging 0.78
R1956:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1957:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1962:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
R1994:Vmn2r84 UTSW 10 130386009 missense probably damaging 1.00
R2124:Vmn2r84 UTSW 10 130391231 missense probably damaging 0.99
R2409:Vmn2r84 UTSW 10 130392071 missense probably damaging 0.99
R2474:Vmn2r84 UTSW 10 130386523 missense possibly damaging 0.50
R2851:Vmn2r84 UTSW 10 130394167 missense probably benign 0.05
R3508:Vmn2r84 UTSW 10 130390908 missense probably damaging 1.00
R3792:Vmn2r84 UTSW 10 130385800 makesense probably null
R4051:Vmn2r84 UTSW 10 130390898 missense probably damaging 1.00
R4061:Vmn2r84 UTSW 10 130386029 missense probably damaging 1.00
R4091:Vmn2r84 UTSW 10 130391369 missense probably damaging 1.00
R4190:Vmn2r84 UTSW 10 130391294 nonsense probably null
R4520:Vmn2r84 UTSW 10 130386522 missense probably damaging 1.00
R4584:Vmn2r84 UTSW 10 130390713 missense probably benign 0.00
R4588:Vmn2r84 UTSW 10 130385940 missense probably damaging 0.98
R4655:Vmn2r84 UTSW 10 130394104 nonsense probably null
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R5022:Vmn2r84 UTSW 10 130386548 missense probably damaging 1.00
R5146:Vmn2r84 UTSW 10 130386102 missense probably damaging 1.00
R5237:Vmn2r84 UTSW 10 130385994 missense probably damaging 0.99
R5695:Vmn2r84 UTSW 10 130389195 missense probably benign 0.12
R5793:Vmn2r84 UTSW 10 130385885 missense probably damaging 0.99
R6210:Vmn2r84 UTSW 10 130386245 missense probably damaging 1.00
R6286:Vmn2r84 UTSW 10 130390868 missense possibly damaging 0.65
R6580:Vmn2r84 UTSW 10 130389241 missense possibly damaging 0.93
R6818:Vmn2r84 UTSW 10 130386278 missense probably benign 0.09
R6956:Vmn2r84 UTSW 10 130389267 missense probably damaging 0.98
R6994:Vmn2r84 UTSW 10 130391007 missense possibly damaging 0.90
R7075:Vmn2r84 UTSW 10 130391072 missense probably damaging 0.99
R7225:Vmn2r84 UTSW 10 130386683 missense probably damaging 0.99
R7252:Vmn2r84 UTSW 10 130386410 missense probably damaging 1.00
R7263:Vmn2r84 UTSW 10 130389208 missense probably damaging 1.00
R7297:Vmn2r84 UTSW 10 130391250 missense probably benign 0.19
R7439:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7441:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7857:Vmn2r84 UTSW 10 130390869 missense probably benign 0.00
R7940:Vmn2r84 UTSW 10 130390869 missense probably benign 0.00
Z1177:Vmn2r84 UTSW 10 130391902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTACCTGCTGACATTCTGTG -3'
(R):5'- ATCACAACCTCACAATGGGATG -3'

Sequencing Primer
(F):5'- ACCTGCTGACATTCTGTGTATTC -3'
(R):5'- ACCTCACAATGGGATGTTATCAC -3'
Posted On2018-06-22