Mutagenetix > Incidental Mutation

Incidental Mutation 'R6640:Trpm3'

525752

Institutional Source

Beutler Lab

Gene Symbol

Trpm3

Ensembl Gene

ENSMUSG00000052387

Gene Name

transient receptor potential cation channel, subfamily M, member 3

Synonyms

6330504P12Rik, LTRPC3, melastatin 2, B930001P07Rik, MLSN2

MMRRC Submission

044761-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R6640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

22116410-22972774 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22955946 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1126 (I1126K)

Ref Sequence

ENSEMBL: ENSMUSP00000074328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037901] [ENSMUST00000074770] [ENSMUST00000087576] [ENSMUST00000099569]

AlphaFold

J9S314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037901
AA Change: I1134K

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000042184
Gene: ENSMUSG00000052387
AA Change: I1134K

Domain	Start	End	E-Value	Type
Blast:ANK	485	514	1e-6	BLAST
low complexity region	619	631	N/A	INTRINSIC
low complexity region	674	689	N/A	INTRINSIC
low complexity region	788	800	N/A	INTRINSIC
low complexity region	821	840	N/A	INTRINSIC
Pfam:Ion_trans	883	1136	1.7e-19	PFAM
Pfam:TRPM_tetra	1227	1282	1.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000074770
AA Change: I1126K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074328
Gene: ENSMUSG00000052387
AA Change: I1126K

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	611	623	N/A	INTRINSIC
low complexity region	666	681	N/A	INTRINSIC
low complexity region	780	792	N/A	INTRINSIC
low complexity region	813	832	N/A	INTRINSIC
transmembrane domain	874	896	N/A	INTRINSIC
Pfam:Ion_trans	908	1116	5.1e-14	PFAM
low complexity region	1378	1388	N/A	INTRINSIC
low complexity region	1433	1455	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000087576
AA Change: I1136K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084857
Gene: ENSMUSG00000052387
AA Change: I1136K

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	5e-7	BLAST
low complexity region	621	633	N/A	INTRINSIC
low complexity region	676	691	N/A	INTRINSIC
low complexity region	790	802	N/A	INTRINSIC
low complexity region	823	842	N/A	INTRINSIC
transmembrane domain	884	906	N/A	INTRINSIC
Pfam:Ion_trans	918	1126	5.1e-14	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000099569
AA Change: I1136K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097164
Gene: ENSMUSG00000052387
AA Change: I1136K

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
Blast:ANK	487	516	6e-7	BLAST
low complexity region	609	621	N/A	INTRINSIC
low complexity region	664	679	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	811	830	N/A	INTRINSIC
Pfam:Ion_trans	873	1138	3.2e-19	PFAM
Pfam:TRPM_tetra	1229	1284	4.4e-26	PFAM
low complexity region	1388	1398	N/A	INTRINSIC
low complexity region	1443	1465	N/A	INTRINSIC

Meta Mutation Damage Score

0.2233

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

97% (31/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of transient receptor potential (TRP) channels. TRP channels are cation-selective channels important for cellular calcium signaling and homeostasis. The protein encoded by this gene mediates calcium entry, and this entry is potentiated by calcium store depletion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display impaired thermal and chemical nociception. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	T	6: 128,530,248 (GRCm39)	N936K	probably benign	Het
Abca2	A	T	2: 25,337,015 (GRCm39)	Y2318F	possibly damaging	Het
Aldh1b1	A	G	4: 45,803,868 (GRCm39)	T469A	possibly damaging	Het
Aoc1l1	A	G	6: 48,954,605 (GRCm39)	D581G	probably benign	Het
Ccdc136	A	G	6: 29,412,959 (GRCm39)	D382G	possibly damaging	Het
Dapk1	A	G	13: 60,864,628 (GRCm39)	K141E	probably damaging	Het
Dnah6	A	T	6: 73,001,276 (GRCm39)	W3973R	probably damaging	Het
Dock10	G	T	1: 80,511,555 (GRCm39)	S1518*	probably null	Het
Elovl5	C	A	9: 77,887,195 (GRCm39)	Y195*	probably null	Het
Fbxl21	T	A	13: 56,684,822 (GRCm39)	W309R	probably damaging	Het
Gm10801	C	CGTG	2: 98,494,152 (GRCm39)		probably null	Het
Gpx1	A	G	9: 108,217,295 (GRCm39)	D133G	probably damaging	Het
Hoxd1	T	A	2: 74,593,606 (GRCm39)	V54E	probably damaging	Het
Kcnh3	T	C	15: 99,139,649 (GRCm39)	V876A	probably benign	Het
Klri2	G	C	6: 129,709,158 (GRCm39)	F231L	probably benign	Het
Mogat1	T	G	1: 78,500,411 (GRCm39)	S158R	probably damaging	Het
Myo1c	C	T	11: 75,562,461 (GRCm39)	P918S	probably benign	Het
Or2ag13	T	A	7: 106,313,247 (GRCm39)	I214F	probably damaging	Het
Or8k16	T	A	2: 85,520,279 (GRCm39)	C169S	probably damaging	Het
Otog	G	A	7: 45,911,167 (GRCm39)	A673T	possibly damaging	Het
Pigm	T	C	1: 172,205,254 (GRCm39)	V330A	probably damaging	Het
Rab33b	A	G	3: 51,391,900 (GRCm39)	T50A	possibly damaging	Het
Raver2	C	T	4: 100,988,500 (GRCm39)	P371L	probably damaging	Het
Rpl15-ps6	G	T	15: 52,341,016 (GRCm39)		noncoding transcript	Het
Sh3rf2	T	A	18: 42,234,705 (GRCm39)	Y163N	probably damaging	Het
Slc1a1	T	C	19: 28,871,970 (GRCm39)		probably null	Het
Slc6a18	T	A	13: 73,812,401 (GRCm39)	Y563F	possibly damaging	Het
Sp3	A	G	2: 72,801,458 (GRCm39)	L185P	possibly damaging	Het
Thbs2	T	C	17: 14,893,630 (GRCm39)	D850G	possibly damaging	Het
Tmem161b	C	A	13: 84,370,537 (GRCm39)		probably benign	Het
Tmtc2	T	A	10: 105,409,610 (GRCm39)	M1L	probably benign	Het
Trpm2	C	T	10: 77,773,660 (GRCm39)	R585Q	probably benign	Het
Ugt1a6b	A	C	1: 88,035,516 (GRCm39)	T285P	probably benign	Het
Vps13b	A	G	15: 35,617,842 (GRCm39)	T1181A	possibly damaging	Het

Other mutations in Trpm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Trpm3	APN	19	22,965,023 (GRCm39)	missense	probably benign	0.00
IGL00773:Trpm3	APN	19	22,877,523 (GRCm39)	missense	possibly damaging	0.92
IGL00852:Trpm3	APN	19	22,964,435 (GRCm39)	missense	possibly damaging	0.93
IGL01597:Trpm3	APN	19	22,692,610 (GRCm39)	missense	probably damaging	1.00
IGL01607:Trpm3	APN	19	22,964,491 (GRCm39)	missense	probably benign	0.01
IGL01818:Trpm3	APN	19	22,891,838 (GRCm39)	missense	probably damaging	1.00
IGL01890:Trpm3	APN	19	22,689,083 (GRCm39)	missense	probably damaging	0.98
IGL02016:Trpm3	APN	19	22,879,433 (GRCm39)	nonsense	probably null
IGL02324:Trpm3	APN	19	22,676,143 (GRCm39)	missense	probably benign	0.25
IGL02947:Trpm3	APN	19	22,878,483 (GRCm39)	missense	probably damaging	0.99
IGL03037:Trpm3	APN	19	22,866,776 (GRCm39)	missense	possibly damaging	0.85
IGL03128:Trpm3	APN	19	22,891,829 (GRCm39)	missense	probably damaging	1.00
IGL03335:Trpm3	APN	19	22,903,435 (GRCm39)	critical splice donor site	probably null
IGL03354:Trpm3	APN	19	22,834,082 (GRCm39)	missense	probably damaging	1.00
bit	UTSW	19	22,965,233 (GRCm39)	missense	probably benign	0.00
G1patch:Trpm3	UTSW	19	22,903,392 (GRCm39)	missense	probably damaging	1.00
P0041:Trpm3	UTSW	19	22,875,050 (GRCm39)	missense	probably benign	0.01
R0001:Trpm3	UTSW	19	22,692,695 (GRCm39)	missense	possibly damaging	0.70
R0007:Trpm3	UTSW	19	22,964,893 (GRCm39)	missense	probably benign	0.00
R0007:Trpm3	UTSW	19	22,964,893 (GRCm39)	missense	probably benign	0.00
R0009:Trpm3	UTSW	19	22,891,810 (GRCm39)	missense	probably damaging	1.00
R0009:Trpm3	UTSW	19	22,891,810 (GRCm39)	missense	probably damaging	1.00
R0142:Trpm3	UTSW	19	22,965,280 (GRCm39)	missense	probably damaging	0.98
R0194:Trpm3	UTSW	19	22,692,720 (GRCm39)	splice site	probably null
R0268:Trpm3	UTSW	19	22,874,885 (GRCm39)	critical splice donor site	probably null
R0299:Trpm3	UTSW	19	22,964,237 (GRCm39)	missense	possibly damaging	0.62
R0449:Trpm3	UTSW	19	22,965,418 (GRCm39)	missense	probably benign
R0481:Trpm3	UTSW	19	22,878,435 (GRCm39)	missense	possibly damaging	0.51
R0496:Trpm3	UTSW	19	22,676,142 (GRCm39)	missense	probably benign	0.00
R0499:Trpm3	UTSW	19	22,964,237 (GRCm39)	missense	possibly damaging	0.62
R0550:Trpm3	UTSW	19	22,965,176 (GRCm39)	missense	probably damaging	0.97
R0729:Trpm3	UTSW	19	22,965,153 (GRCm39)	missense	probably benign
R0883:Trpm3	UTSW	19	22,956,018 (GRCm39)	missense	probably damaging	1.00
R0926:Trpm3	UTSW	19	22,965,407 (GRCm39)	missense	probably benign	0.02
R1185:Trpm3	UTSW	19	22,891,781 (GRCm39)	splice site	probably benign
R1185:Trpm3	UTSW	19	22,891,781 (GRCm39)	splice site	probably benign
R1513:Trpm3	UTSW	19	22,964,236 (GRCm39)	missense	possibly damaging	0.96
R1521:Trpm3	UTSW	19	22,878,585 (GRCm39)	missense	probably damaging	1.00
R1522:Trpm3	UTSW	19	22,955,698 (GRCm39)	missense	probably benign	0.39
R1569:Trpm3	UTSW	19	22,866,809 (GRCm39)	critical splice donor site	probably null
R1598:Trpm3	UTSW	19	22,710,388 (GRCm39)	missense	possibly damaging	0.47
R1600:Trpm3	UTSW	19	22,116,519 (GRCm39)	missense	probably benign	0.00
R1616:Trpm3	UTSW	19	22,960,076 (GRCm39)	missense	probably damaging	1.00
R1619:Trpm3	UTSW	19	22,689,271 (GRCm39)	missense	probably damaging	0.99
R1923:Trpm3	UTSW	19	22,862,776 (GRCm39)	missense	probably damaging	1.00
R1985:Trpm3	UTSW	19	22,903,446 (GRCm39)	missense	possibly damaging	0.56
R2002:Trpm3	UTSW	19	22,959,947 (GRCm39)	missense	probably damaging	1.00
R2249:Trpm3	UTSW	19	22,710,398 (GRCm39)	missense	probably benign	0.15
R3719:Trpm3	UTSW	19	22,964,354 (GRCm39)	missense	possibly damaging	0.95
R3766:Trpm3	UTSW	19	22,425,741 (GRCm39)	missense	probably benign
R3774:Trpm3	UTSW	19	22,965,339 (GRCm39)	missense	probably benign	0.03
R3774:Trpm3	UTSW	19	22,955,966 (GRCm39)	missense	possibly damaging	0.66
R3776:Trpm3	UTSW	19	22,955,966 (GRCm39)	missense	possibly damaging	0.66
R3820:Trpm3	UTSW	19	22,964,813 (GRCm39)	missense	probably benign	0.00
R3899:Trpm3	UTSW	19	22,878,524 (GRCm39)	missense	possibly damaging	0.90
R4204:Trpm3	UTSW	19	22,964,928 (GRCm39)	missense	probably benign	0.00
R4238:Trpm3	UTSW	19	22,956,002 (GRCm39)	missense	probably damaging	1.00
R4301:Trpm3	UTSW	19	22,964,656 (GRCm39)	missense	probably benign	0.23
R4344:Trpm3	UTSW	19	22,875,061 (GRCm39)	missense	probably damaging	0.99
R4345:Trpm3	UTSW	19	22,875,061 (GRCm39)	missense	probably damaging	0.99
R4365:Trpm3	UTSW	19	22,955,694 (GRCm39)	missense	probably benign	0.00
R4510:Trpm3	UTSW	19	22,965,381 (GRCm39)	missense	probably benign	0.00
R4511:Trpm3	UTSW	19	22,965,381 (GRCm39)	missense	probably benign	0.00
R4565:Trpm3	UTSW	19	22,965,233 (GRCm39)	missense	probably benign	0.00
R4573:Trpm3	UTSW	19	22,879,506 (GRCm39)	missense	probably damaging	1.00
R4606:Trpm3	UTSW	19	22,955,988 (GRCm39)	missense	probably benign	0.26
R4677:Trpm3	UTSW	19	22,964,752 (GRCm39)	missense	possibly damaging	0.95
R4684:Trpm3	UTSW	19	22,965,145 (GRCm39)	missense	probably benign
R4713:Trpm3	UTSW	19	22,866,799 (GRCm39)	missense	possibly damaging	0.83
R4745:Trpm3	UTSW	19	22,692,659 (GRCm39)	missense	possibly damaging	0.67
R5015:Trpm3	UTSW	19	22,689,076 (GRCm39)	missense	probably damaging	1.00
R5030:Trpm3	UTSW	19	22,676,130 (GRCm39)	missense	probably benign	0.01
R5074:Trpm3	UTSW	19	22,862,713 (GRCm39)	missense	possibly damaging	0.65
R5089:Trpm3	UTSW	19	22,744,120 (GRCm39)	missense	probably damaging	0.97
R5100:Trpm3	UTSW	19	22,896,130 (GRCm39)	missense	probably damaging	0.99
R5108:Trpm3	UTSW	19	22,882,078 (GRCm39)	missense	probably benign	0.06
R5204:Trpm3	UTSW	19	22,425,705 (GRCm39)	nonsense	probably null
R5213:Trpm3	UTSW	19	22,674,818 (GRCm39)	nonsense	probably null
R5358:Trpm3	UTSW	19	22,903,332 (GRCm39)	missense	probably damaging	1.00
R5374:Trpm3	UTSW	19	22,903,548 (GRCm39)	nonsense	probably null
R5382:Trpm3	UTSW	19	22,862,705 (GRCm39)	splice site	probably null
R5509:Trpm3	UTSW	19	22,964,622 (GRCm39)	missense	probably damaging	0.99
R5558:Trpm3	UTSW	19	22,955,937 (GRCm39)	missense	probably damaging	1.00
R6154:Trpm3	UTSW	19	22,965,178 (GRCm39)	missense	probably damaging	1.00
R6250:Trpm3	UTSW	19	22,887,418 (GRCm39)	missense	probably benign	0.01
R6433:Trpm3	UTSW	19	22,878,669 (GRCm39)	missense	probably damaging	1.00
R6542:Trpm3	UTSW	19	22,903,477 (GRCm39)	missense	probably benign	0.04
R6630:Trpm3	UTSW	19	22,965,347 (GRCm39)	missense	probably benign	0.00
R6725:Trpm3	UTSW	19	22,903,392 (GRCm39)	missense	probably damaging	1.00
R7275:Trpm3	UTSW	19	22,956,048 (GRCm39)	missense	possibly damaging	0.71
R7371:Trpm3	UTSW	19	22,879,557 (GRCm39)	missense	probably benign	0.27
R7467:Trpm3	UTSW	19	22,955,698 (GRCm39)	missense	possibly damaging	0.82
R7488:Trpm3	UTSW	19	22,955,937 (GRCm39)	missense	probably damaging	1.00
R7495:Trpm3	UTSW	19	22,875,160 (GRCm39)	missense	probably benign	0.28
R7600:Trpm3	UTSW	19	22,903,458 (GRCm39)	missense	possibly damaging	0.68
R7710:Trpm3	UTSW	19	22,896,154 (GRCm39)	missense	probably damaging	0.97
R7877:Trpm3	UTSW	19	22,882,148 (GRCm39)	missense	probably benign	0.25
R8184:Trpm3	UTSW	19	22,896,060 (GRCm39)	missense	possibly damaging	0.46
R8234:Trpm3	UTSW	19	22,692,640 (GRCm39)	missense	possibly damaging	0.47
R8236:Trpm3	UTSW	19	22,964,772 (GRCm39)	missense	probably benign	0.00
R8443:Trpm3	UTSW	19	22,676,226 (GRCm39)	missense	possibly damaging	0.90
R8470:Trpm3	UTSW	19	22,887,501 (GRCm39)	missense	possibly damaging	0.91
R8784:Trpm3	UTSW	19	22,896,040 (GRCm39)	missense	probably benign	0.07
R8816:Trpm3	UTSW	19	22,965,580 (GRCm39)	missense	probably damaging	0.97
R8818:Trpm3	UTSW	19	22,955,952 (GRCm39)	missense	possibly damaging	0.81
R8875:Trpm3	UTSW	19	22,887,493 (GRCm39)	missense	probably damaging	1.00
R8931:Trpm3	UTSW	19	22,744,034 (GRCm39)	missense	probably damaging	1.00
R8969:Trpm3	UTSW	19	22,903,308 (GRCm39)	missense	probably damaging	0.98
R8987:Trpm3	UTSW	19	22,896,124 (GRCm39)	missense	probably damaging	1.00
R9300:Trpm3	UTSW	19	22,955,745 (GRCm39)	missense	possibly damaging	0.49
R9327:Trpm3	UTSW	19	22,896,004 (GRCm39)	missense	possibly damaging	0.56
R9354:Trpm3	UTSW	19	22,425,696 (GRCm39)	missense	probably benign
R9514:Trpm3	UTSW	19	22,960,040 (GRCm39)	missense	probably benign	0.42
R9545:Trpm3	UTSW	19	22,878,458 (GRCm39)	missense	probably benign	0.24
R9712:Trpm3	UTSW	19	22,692,716 (GRCm39)	missense	possibly damaging	0.55
R9721:Trpm3	UTSW	19	22,866,762 (GRCm39)	missense	probably benign	0.00
R9750:Trpm3	UTSW	19	22,903,495 (GRCm39)	missense	probably benign	0.00
Z1176:Trpm3	UTSW	19	22,964,854 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAACATCCTTCTGGTCAACCTC -3'
(R):5'- TGGGAATTGCTGGGAACTTC -3'

Sequencing Primer
(F):5'- CCTTATTGCCGTCTTCAAGTGAGTG -3'
(R):5'- TTGCAGCTCACTCAGGC -3'

Posted On

2018-06-22