Incidental Mutation 'R6607:Foxq1'
ID525764
Institutional Source Beutler Lab
Gene Symbol Foxq1
Ensembl Gene ENSMUSG00000038415
Gene Nameforkhead box Q1
SynonymsHfh1l, sa, Hfh1, HFH-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.598) question?
Stock #R6607 (G1)
Quality Score120.008
Status Validated
Chromosome13
Chromosomal Location31556134-31560976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31559146 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000036952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042118] [ENSMUST00000170573]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042118
AA Change: D77G

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036952
Gene: ENSMUSG00000038415
AA Change: D77G

DomainStartEndE-ValueType
low complexity region 32 72 N/A INTRINSIC
low complexity region 89 105 N/A INTRINSIC
FH 113 204 3.98e-50 SMART
low complexity region 206 211 N/A INTRINSIC
low complexity region 225 254 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 296 325 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000170573
SMART Domains Protein: ENSMUSP00000129167
Gene: ENSMUSG00000090863

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
low complexity region 44 67 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
low complexity region 168 186 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FOXQ1 is a member of the FOX gene family, which is characterized by a conserved 110-amino acid DNA-binding motif called the forkhead or winged helix domain. FOX genes are involved in embryonic development, cell cycle regulation, tissue-specific gene expression, cell signaling, and tumorigenesis (Bieller et al., 2001 [PubMed 11747606]).[supplied by OMIM, May 2009]
PHENOTYPE: Mutations in this gene affect coat color and texture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Foxq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Foxq1 APN 13 31559277 missense probably damaging 1.00
IGL01398:Foxq1 APN 13 31559451 missense probably damaging 1.00
IGL02217:Foxq1 APN 13 31559169 missense probably damaging 0.98
IGL02471:Foxq1 APN 13 31559343 missense possibly damaging 0.87
H8786:Foxq1 UTSW 13 31559458 missense probably damaging 1.00
R1387:Foxq1 UTSW 13 31559305 missense probably damaging 1.00
R2436:Foxq1 UTSW 13 31558533 utr 3 prime probably benign
R4566:Foxq1 UTSW 13 31559488 missense probably benign 0.17
R4612:Foxq1 UTSW 13 31558825 start gained probably benign
R5761:Foxq1 UTSW 13 31559331 missense probably damaging 0.99
R6230:Foxq1 UTSW 13 31559508 missense probably damaging 1.00
R7983:Foxq1 UTSW 13 31559989 missense possibly damaging 0.85
R8321:Foxq1 UTSW 13 31559268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGGAGGTGTTCGTCCCAC -3'
(R):5'- TACTCGTTGATCTCGGCCAG -3'

Sequencing Primer
(F):5'- CAAAATGGGCAGCGATCTG -3'
(R):5'- TGATCTCGGCCAGTGTCAG -3'
Posted On2018-06-22