Incidental Mutation 'R6607:Adtrp'
ID525766
Institutional Source Beutler Lab
Gene Symbol Adtrp
Ensembl Gene ENSMUSG00000058022
Gene Nameandrogen dependent TFPI regulating protein
Synonyms9530008L14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location41763148-41847684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41777611 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 167 (F167L)
Ref Sequence ENSEMBL: ENSMUSP00000071899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072012] [ENSMUST00000121404] [ENSMUST00000137905] [ENSMUST00000179758] [ENSMUST00000220680] [ENSMUST00000223337]
Predicted Effect probably benign
Transcript: ENSMUST00000072012
AA Change: F167L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071899
Gene: ENSMUSG00000058022
AA Change: F167L

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 37 248 1.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121404
AA Change: F135L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113661
Gene: ENSMUSG00000058022
AA Change: F135L

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 5 216 4.5e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137905
AA Change: F135L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122312
Gene: ENSMUSG00000058022
AA Change: F135L

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 5 167 7.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179758
AA Change: F135L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137365
Gene: ENSMUSG00000058022
AA Change: F135L

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 5 216 4.5e-63 PFAM
Predicted Effect silent
Transcript: ENSMUST00000220680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220949
Predicted Effect probably benign
Transcript: ENSMUST00000223337
AA Change: F46L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Adtrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Adtrp APN 13 41777602 missense probably benign 0.06
PIT4810001:Adtrp UTSW 13 41828248 nonsense probably null
R0008:Adtrp UTSW 13 41767465 missense probably damaging 1.00
R0606:Adtrp UTSW 13 41767405 missense probably damaging 1.00
R1165:Adtrp UTSW 13 41814303 missense probably damaging 0.99
R1183:Adtrp UTSW 13 41828337 utr 5 prime probably benign
R2030:Adtrp UTSW 13 41828259 missense probably damaging 0.98
R2169:Adtrp UTSW 13 41767429 missense possibly damaging 0.89
R4722:Adtrp UTSW 13 41767347 missense probably benign 0.03
R5171:Adtrp UTSW 13 41777563 missense probably damaging 1.00
R5892:Adtrp UTSW 13 41828206 missense probably benign 0.04
R7074:Adtrp UTSW 13 41828141 critical splice donor site probably null
R7454:Adtrp UTSW 13 41828315 missense unknown
R7610:Adtrp UTSW 13 41816194 missense probably benign 0.00
R8007:Adtrp UTSW 13 41816231 missense probably damaging 1.00
R8272:Adtrp UTSW 13 41816154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGAACCCGGCTCTCCTG -3'
(R):5'- TGGTAGTACATTTCCAAAGGCC -3'

Sequencing Primer
(F):5'- CCGGCTCTCCTGGAAATTTAAAGG -3'
(R):5'- GTACATTTCCAAAGGCCTTAGAAAC -3'
Posted On2018-06-22