Incidental Mutation 'R6641:Klk10'
ID525797
Institutional Source Beutler Lab
Gene Symbol Klk10
Ensembl Gene ENSMUSG00000030693
Gene Namekallikrein related-peptidase 10
SynonymsNES1, PRSSL1, 2300002A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6641 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location43781035-43785410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43784900 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 239 (D239Y)
Ref Sequence ENSEMBL: ENSMUSP00000014058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014058
AA Change: D239Y

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000014058
Gene: ENSMUSG00000030693
AA Change: D239Y

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 46 271 1.35e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Its encoded protein is secreted and may play a role in suppression of tumorigenesis in breast and prostate cancers. Alternate splicing of this gene results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,245 I193V possibly damaging Het
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Aadac T C 3: 60,039,732 S284P probably damaging Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Gm3404 C A 5: 146,527,708 A173D probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc22a15 G A 3: 101,875,706 A216V possibly damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Slc7a13 G A 4: 19,839,534 G379E probably damaging Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Spef2 A T 15: 9,625,973 M1169K probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in Klk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Klk10 APN 7 43784976 missense probably damaging 1.00
IGL01657:Klk10 APN 7 43781589 missense possibly damaging 0.49
IGL02049:Klk10 APN 7 43784458 splice site probably benign
IGL02725:Klk10 APN 7 43781620 missense probably damaging 1.00
IGL03382:Klk10 APN 7 43784459 splice site probably benign
R0433:Klk10 UTSW 7 43781565 missense possibly damaging 0.51
R1521:Klk10 UTSW 7 43782880 missense probably benign 0.00
R1580:Klk10 UTSW 7 43782862 missense probably damaging 1.00
R4825:Klk10 UTSW 7 43783598 missense probably damaging 1.00
R5969:Klk10 UTSW 7 43784985 missense probably damaging 1.00
R6437:Klk10 UTSW 7 43782817 missense probably benign 0.04
R7589:Klk10 UTSW 7 43783627 missense probably benign 0.00
R7599:Klk10 UTSW 7 43784427 missense probably benign 0.03
R7902:Klk10 UTSW 7 43783518 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- ATGCCACCATCACCTCTGTG -3'
(R):5'- TACTAGAACTTTCTCAGCCACC -3'

Sequencing Primer
(F):5'- ACCATCACCTCTGTGTGTATC -3'
(R):5'- TCTGCATTTGTGAGCAGAGAAC -3'
Posted On2018-06-22