Incidental Mutation 'R6641:Pik3c2a'
ID 525799
Institutional Source Beutler Lab
Gene Symbol Pik3c2a
Ensembl Gene ENSMUSG00000030660
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms PI3KC2
MMRRC Submission 044762-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6641 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 115936500-116042684 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 115939460 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000170430
SMART Domains Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
PI3K_rbd 410 513 3.08e-38 SMART
PI3K_C2 674 783 2.71e-34 SMART
PI3Ka 860 1047 3.62e-85 SMART
PI3Kc 1134 1396 3.1e-125 SMART
PX 1422 1534 5.68e-30 SMART
C2 1573 1677 3.93e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205941
Predicted Effect probably null
Transcript: ENSMUST00000206219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206248
Predicted Effect probably benign
Transcript: ENSMUST00000206385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206805
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik C T 16: 88,555,974 (GRCm39) P63S unknown Het
Aadac T C 3: 59,947,153 (GRCm39) S284P probably damaging Het
Casp12 G A 9: 5,354,612 (GRCm39) C257Y probably benign Het
Chil6 T A 3: 106,296,240 (GRCm39) I361F possibly damaging Het
Cubn A C 2: 13,480,875 (GRCm39) S327A probably damaging Het
Desi2 A T 1: 178,071,943 (GRCm39) E82D possibly damaging Het
Dym T A 18: 75,189,712 (GRCm39) I100N probably damaging Het
Gm14418 G T 2: 177,079,623 (GRCm39) T124K probably benign Het
Gm28042 T A 2: 119,870,164 (GRCm39) I701N probably damaging Het
Gm3404 C A 5: 146,464,518 (GRCm39) A173D probably damaging Het
Hipk1 A T 3: 103,660,721 (GRCm39) L738Q probably damaging Het
Klk10 G T 7: 43,434,324 (GRCm39) D239Y possibly damaging Het
Kmt2a T C 9: 44,731,132 (GRCm39) probably benign Het
Lepr T A 4: 101,622,502 (GRCm39) D427E probably damaging Het
Lrp5 G A 19: 3,702,287 (GRCm39) R177W probably damaging Het
Mtg2 A G 2: 179,727,301 (GRCm39) T318A probably benign Het
Myh7 A G 14: 55,219,737 (GRCm39) V1044A probably benign Het
Nrsn2 A G 2: 152,211,830 (GRCm39) V67A probably benign Het
Or2b11 T C 11: 59,461,666 (GRCm39) D300G possibly damaging Het
Pcdha8 A G 18: 37,126,850 (GRCm39) E444G probably damaging Het
Pdgfra T C 5: 75,322,762 (GRCm39) probably benign Het
Prpf40a T G 2: 53,031,638 (GRCm39) probably benign Het
Reln A C 5: 22,134,132 (GRCm39) Y2599D probably damaging Het
Septin11 T A 5: 93,287,411 (GRCm39) I42N probably damaging Het
Slc22a15 G A 3: 101,783,022 (GRCm39) A216V possibly damaging Het
Slc33a1 T A 3: 63,861,327 (GRCm39) T292S probably benign Het
Slc5a11 A G 7: 122,837,378 (GRCm39) K56R probably benign Het
Slc7a13 G A 4: 19,839,534 (GRCm39) G379E probably damaging Het
Spata31g1 A G 4: 42,971,245 (GRCm39) I193V possibly damaging Het
Specc1l A G 10: 75,082,383 (GRCm39) E593G probably damaging Het
Spef2 A T 15: 9,626,059 (GRCm39) M1169K probably damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Vipr1 A G 9: 121,498,631 (GRCm39) *460W probably null Het
Zbtb18 T A 1: 177,275,609 (GRCm39) L323Q probably damaging Het
Zfyve1 A G 12: 83,641,270 (GRCm39) S129P probably benign Het
Other mutations in Pik3c2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Pik3c2a APN 7 115,975,518 (GRCm39) missense possibly damaging 0.50
IGL00732:Pik3c2a APN 7 115,963,735 (GRCm39) missense possibly damaging 0.82
IGL01303:Pik3c2a APN 7 115,973,038 (GRCm39) missense possibly damaging 0.94
IGL01443:Pik3c2a APN 7 116,017,429 (GRCm39) missense probably benign 0.01
IGL01462:Pik3c2a APN 7 115,975,485 (GRCm39) missense possibly damaging 0.94
IGL01641:Pik3c2a APN 7 115,950,000 (GRCm39) intron probably benign
IGL01695:Pik3c2a APN 7 116,016,753 (GRCm39) missense possibly damaging 0.82
IGL02095:Pik3c2a APN 7 115,945,423 (GRCm39) missense probably damaging 1.00
IGL02137:Pik3c2a APN 7 115,950,039 (GRCm39) missense probably benign 0.00
IGL02160:Pik3c2a APN 7 115,987,299 (GRCm39) missense probably damaging 1.00
IGL02224:Pik3c2a APN 7 115,962,575 (GRCm39) splice site probably benign
IGL02345:Pik3c2a APN 7 116,005,126 (GRCm39) missense probably damaging 1.00
IGL02644:Pik3c2a APN 7 115,972,049 (GRCm39) missense probably benign 0.00
IGL02756:Pik3c2a APN 7 115,963,748 (GRCm39) missense probably benign 0.01
IGL03339:Pik3c2a APN 7 116,017,256 (GRCm39) missense possibly damaging 0.57
IGL03412:Pik3c2a APN 7 116,017,074 (GRCm39) missense probably benign 0.21
R0046:Pik3c2a UTSW 7 115,953,307 (GRCm39) missense probably damaging 1.00
R0387:Pik3c2a UTSW 7 115,972,979 (GRCm39) missense probably damaging 1.00
R0501:Pik3c2a UTSW 7 115,953,290 (GRCm39) missense probably damaging 1.00
R0650:Pik3c2a UTSW 7 115,945,482 (GRCm39) splice site probably benign
R0991:Pik3c2a UTSW 7 115,961,280 (GRCm39) critical splice donor site probably null
R1074:Pik3c2a UTSW 7 115,950,160 (GRCm39) nonsense probably null
R1485:Pik3c2a UTSW 7 116,016,908 (GRCm39) missense possibly damaging 0.50
R1495:Pik3c2a UTSW 7 115,987,300 (GRCm39) missense probably benign 0.01
R1510:Pik3c2a UTSW 7 115,987,280 (GRCm39) missense probably benign 0.00
R1654:Pik3c2a UTSW 7 115,968,083 (GRCm39) missense probably benign 0.02
R1711:Pik3c2a UTSW 7 116,017,162 (GRCm39) nonsense probably null
R1733:Pik3c2a UTSW 7 116,017,755 (GRCm39) start codon destroyed possibly damaging 0.96
R1751:Pik3c2a UTSW 7 115,945,471 (GRCm39) missense probably damaging 0.98
R1812:Pik3c2a UTSW 7 116,016,899 (GRCm39) missense probably damaging 0.98
R1817:Pik3c2a UTSW 7 115,975,747 (GRCm39) critical splice donor site probably null
R1826:Pik3c2a UTSW 7 115,967,352 (GRCm39) missense probably benign
R1875:Pik3c2a UTSW 7 116,017,206 (GRCm39) missense probably benign 0.35
R1995:Pik3c2a UTSW 7 115,953,241 (GRCm39) missense probably damaging 1.00
R2007:Pik3c2a UTSW 7 115,941,472 (GRCm39) missense probably damaging 1.00
R2009:Pik3c2a UTSW 7 115,963,738 (GRCm39) missense probably damaging 1.00
R2013:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2014:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2015:Pik3c2a UTSW 7 115,950,166 (GRCm39) critical splice acceptor site probably null
R2027:Pik3c2a UTSW 7 115,950,057 (GRCm39) missense probably damaging 1.00
R2050:Pik3c2a UTSW 7 116,016,686 (GRCm39) critical splice donor site probably null
R2068:Pik3c2a UTSW 7 115,972,126 (GRCm39) nonsense probably null
R3814:Pik3c2a UTSW 7 115,947,414 (GRCm39) missense probably damaging 1.00
R3848:Pik3c2a UTSW 7 115,963,785 (GRCm39) nonsense probably null
R4386:Pik3c2a UTSW 7 115,953,334 (GRCm39) missense probably damaging 1.00
R4668:Pik3c2a UTSW 7 115,957,923 (GRCm39) missense probably benign 0.16
R4783:Pik3c2a UTSW 7 116,017,060 (GRCm39) missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 115,939,391 (GRCm39) missense probably damaging 1.00
R4860:Pik3c2a UTSW 7 115,939,391 (GRCm39) missense probably damaging 1.00
R5057:Pik3c2a UTSW 7 115,975,518 (GRCm39) missense possibly damaging 0.50
R5080:Pik3c2a UTSW 7 115,947,509 (GRCm39) missense probably damaging 1.00
R5083:Pik3c2a UTSW 7 115,941,636 (GRCm39) missense probably damaging 1.00
R5144:Pik3c2a UTSW 7 115,950,021 (GRCm39) missense probably benign 0.01
R5589:Pik3c2a UTSW 7 116,016,893 (GRCm39) missense probably benign 0.02
R5646:Pik3c2a UTSW 7 116,005,186 (GRCm39) missense probably damaging 1.00
R5829:Pik3c2a UTSW 7 115,972,049 (GRCm39) missense probably benign 0.00
R5951:Pik3c2a UTSW 7 115,967,419 (GRCm39) missense probably damaging 0.96
R5958:Pik3c2a UTSW 7 115,961,799 (GRCm39) missense probably damaging 1.00
R6356:Pik3c2a UTSW 7 115,947,440 (GRCm39) missense possibly damaging 0.46
R6551:Pik3c2a UTSW 7 116,016,731 (GRCm39) missense probably damaging 0.97
R6661:Pik3c2a UTSW 7 115,967,993 (GRCm39) missense possibly damaging 0.77
R6789:Pik3c2a UTSW 7 115,961,419 (GRCm39) missense probably damaging 1.00
R6874:Pik3c2a UTSW 7 115,993,540 (GRCm39) missense probably damaging 1.00
R6985:Pik3c2a UTSW 7 116,017,223 (GRCm39) missense probably damaging 0.98
R7106:Pik3c2a UTSW 7 116,017,368 (GRCm39) nonsense probably null
R7153:Pik3c2a UTSW 7 115,941,487 (GRCm39) missense probably damaging 1.00
R7176:Pik3c2a UTSW 7 115,987,331 (GRCm39) missense possibly damaging 0.47
R7265:Pik3c2a UTSW 7 115,987,321 (GRCm39) missense probably damaging 1.00
R7303:Pik3c2a UTSW 7 116,005,178 (GRCm39) missense probably benign 0.00
R7308:Pik3c2a UTSW 7 115,973,074 (GRCm39) missense probably damaging 1.00
R7375:Pik3c2a UTSW 7 115,975,621 (GRCm39) missense probably damaging 1.00
R7406:Pik3c2a UTSW 7 115,953,242 (GRCm39) missense probably damaging 1.00
R7426:Pik3c2a UTSW 7 115,972,089 (GRCm39) missense probably damaging 1.00
R7528:Pik3c2a UTSW 7 115,993,474 (GRCm39) missense probably damaging 1.00
R7539:Pik3c2a UTSW 7 115,939,331 (GRCm39) missense probably damaging 0.97
R7684:Pik3c2a UTSW 7 115,987,312 (GRCm39) nonsense probably null
R7737:Pik3c2a UTSW 7 115,955,488 (GRCm39) missense probably damaging 0.99
R7739:Pik3c2a UTSW 7 115,993,529 (GRCm39) missense probably benign 0.26
R7852:Pik3c2a UTSW 7 116,016,693 (GRCm39) missense probably benign
R7922:Pik3c2a UTSW 7 115,990,517 (GRCm39) missense probably damaging 1.00
R7956:Pik3c2a UTSW 7 115,949,350 (GRCm39) missense probably benign 0.01
R8005:Pik3c2a UTSW 7 116,017,271 (GRCm39) missense probably damaging 1.00
R8158:Pik3c2a UTSW 7 115,942,232 (GRCm39) missense probably benign 0.00
R8329:Pik3c2a UTSW 7 116,017,283 (GRCm39) missense probably damaging 1.00
R8478:Pik3c2a UTSW 7 116,017,584 (GRCm39) missense probably damaging 0.96
R8736:Pik3c2a UTSW 7 115,975,464 (GRCm39) missense possibly damaging 0.47
R8812:Pik3c2a UTSW 7 115,951,112 (GRCm39) missense probably damaging 1.00
R8922:Pik3c2a UTSW 7 116,017,659 (GRCm39) missense probably damaging 1.00
R8953:Pik3c2a UTSW 7 115,987,320 (GRCm39) missense probably benign 0.19
R9105:Pik3c2a UTSW 7 115,972,049 (GRCm39) missense probably benign 0.00
R9111:Pik3c2a UTSW 7 115,993,531 (GRCm39) missense probably damaging 0.99
R9152:Pik3c2a UTSW 7 116,017,004 (GRCm39) missense probably benign 0.30
R9241:Pik3c2a UTSW 7 116,017,115 (GRCm39) missense probably benign 0.02
R9301:Pik3c2a UTSW 7 115,945,413 (GRCm39) missense probably damaging 1.00
R9325:Pik3c2a UTSW 7 115,990,558 (GRCm39) missense probably damaging 0.99
R9482:Pik3c2a UTSW 7 115,961,289 (GRCm39) missense probably benign 0.04
R9513:Pik3c2a UTSW 7 115,939,321 (GRCm39) missense probably benign 0.06
R9569:Pik3c2a UTSW 7 115,957,939 (GRCm39) missense possibly damaging 0.89
R9758:Pik3c2a UTSW 7 115,945,427 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATACGTTGCCGCAGTCAG -3'
(R):5'- GCTCACAGAAACCATGACTGAGAG -3'

Sequencing Primer
(F):5'- TTGCCGCAGTCAGCTGATAC -3'
(R):5'- ACCATGACTGAGAGTTTGGGGATC -3'
Posted On 2018-06-22