Incidental Mutation 'R6609:Ndufb5'
ID525806
Institutional Source Beutler Lab
Gene Symbol Ndufb5
Ensembl Gene ENSMUSG00000027673
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Synonyms0610007D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R6609 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location32736990-32751566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 32741683 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 8 (T8R)
Ref Sequence ENSEMBL: ENSMUSP00000115088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029217] [ENSMUST00000043966] [ENSMUST00000121778] [ENSMUST00000122290] [ENSMUST00000127477] [ENSMUST00000139593] [ENSMUST00000154257]
Predicted Effect probably benign
Transcript: ENSMUST00000029217
Predicted Effect probably benign
Transcript: ENSMUST00000043966
SMART Domains Protein: ENSMUSP00000048078
Gene: ENSMUSG00000037531

DomainStartEndE-ValueType
Pfam:MRP-L47 66 151 4.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121778
SMART Domains Protein: ENSMUSP00000113169
Gene: ENSMUSG00000027673

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 163 5.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122290
SMART Domains Protein: ENSMUSP00000113602
Gene: ENSMUSG00000027673

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 119 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127477
SMART Domains Protein: ENSMUSP00000114963
Gene: ENSMUSG00000027673

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 189 3.5e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139593
AA Change: T8R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000115088
Gene: ENSMUSG00000027673
AA Change: T8R

DomainStartEndE-ValueType
Pfam:NDUF_B5 6 172 6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154257
SMART Domains Protein: ENSMUSP00000117240
Gene: ENSMUSG00000027673

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 135 8.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195565
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,928,762 V421I probably damaging Het
Bpifb3 T A 2: 153,920,648 probably null Het
C1rl T C 6: 124,508,624 V318A probably benign Het
Cacna1b C T 2: 24,653,049 V1264M probably damaging Het
Cacna1s A G 1: 136,113,391 D1551G probably benign Het
Cdc42bpa T G 1: 180,101,274 probably null Het
Cdc7 G A 5: 106,973,058 R182H probably benign Het
Cyth1 A T 11: 118,170,860 L309Q probably damaging Het
Dnah6 G A 6: 73,053,695 T3378I possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Get4 A G 5: 139,269,065 probably benign Het
Gm136 T A 4: 34,746,526 M162L probably benign Het
Grik5 G T 7: 25,015,526 S681* probably null Het
Hsf5 C T 11: 87,635,953 P484S probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kl A T 5: 150,988,962 K725N probably benign Het
Lama3 G A 18: 12,513,678 V144M probably damaging Het
Lrrc14 T C 15: 76,714,253 V363A probably benign Het
Mettl15 T C 2: 109,137,342 R200G probably null Het
Mki67 T C 7: 135,699,829 T1159A possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Olfr1313 T C 2: 112,072,164 M140V probably benign Het
Olfr522 C A 7: 140,162,563 R129L probably benign Het
Pde1a T A 2: 79,906,140 D15V probably damaging Het
Plcg2 G A 8: 117,568,170 G191S probably benign Het
Ptprq T C 10: 107,572,968 T1895A probably damaging Het
Pxdn T C 12: 30,002,941 V1039A probably benign Het
Slc26a5 T C 5: 21,819,719 I456V possibly damaging Het
Smco4 C T 9: 15,544,735 A39V probably damaging Het
Tmem102 T A 11: 69,805,114 L40F probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zfp985 A T 4: 147,583,121 M149L probably benign Het
Zfp985 T C 4: 147,583,667 F331L probably damaging Het
Other mutations in Ndufb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ndufb5 APN 3 32744899 missense probably damaging 0.98
IGL01688:Ndufb5 APN 3 32746464 nonsense probably null
IGL02629:Ndufb5 APN 3 32737199 missense probably benign 0.02
R0084:Ndufb5 UTSW 3 32737203 missense probably benign 0.02
R2851:Ndufb5 UTSW 3 32746451 missense probably damaging 1.00
R5663:Ndufb5 UTSW 3 32747749 missense possibly damaging 0.90
R5742:Ndufb5 UTSW 3 32747781 missense probably damaging 0.99
Z31818:Ndufb5 UTSW 3 32746461 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AACTTCTGAATCCGTGAAGCAG -3'
(R):5'- GCACTGCAGGTGTATCTTGAC -3'

Sequencing Primer
(F):5'- TCCGTGAAGCAGAGAACTGTTCC -3'
(R):5'- AGGTGTATCTTGACCCTCCTTACAG -3'
Posted On2018-06-22