Incidental Mutation 'R6641:Spef2'
ID525819
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6641 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9625973 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1169 (M1169K)
Ref Sequence ENSEMBL: ENSMUSP00000124222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect probably damaging
Transcript: ENSMUST00000160236
AA Change: M1169K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: M1169K

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: M1169K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.6%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A G 4: 42,971,245 I193V possibly damaging Het
2310034C09Rik C T 16: 88,759,086 P63S unknown Het
Aadac T C 3: 60,039,732 S284P probably damaging Het
Casp12 G A 9: 5,354,612 C257Y probably benign Het
Chil6 T A 3: 106,388,924 I361F possibly damaging Het
Cubn A C 2: 13,476,064 S327A probably damaging Het
Desi2 A T 1: 178,244,377 E82D possibly damaging Het
Dym T A 18: 75,056,641 I100N probably damaging Het
Gm14418 G T 2: 177,387,830 T124K probably benign Het
Gm28042 T A 2: 120,039,683 I701N probably damaging Het
Gm3404 C A 5: 146,527,708 A173D probably damaging Het
Hipk1 A T 3: 103,753,405 L738Q probably damaging Het
Klk10 G T 7: 43,784,900 D239Y possibly damaging Het
Kmt2a T C 9: 44,819,835 probably benign Het
Lepr T A 4: 101,765,305 D427E probably damaging Het
Lrp5 G A 19: 3,652,287 R177W probably damaging Het
Mtg2 A G 2: 180,085,508 T318A probably benign Het
Myh7 A G 14: 54,982,280 V1044A probably benign Het
Nrsn2 A G 2: 152,369,910 V67A probably benign Het
Olfr222 T C 11: 59,570,840 D300G possibly damaging Het
Pcdha8 A G 18: 36,993,797 E444G probably damaging Het
Pdgfra T C 5: 75,162,101 probably benign Het
Pik3c2a T C 7: 116,340,225 probably null Het
Prpf40a T G 2: 53,141,626 probably benign Het
Reln A C 5: 21,929,134 Y2599D probably damaging Het
Sept11 T A 5: 93,139,552 I42N probably damaging Het
Slc22a15 G A 3: 101,875,706 A216V possibly damaging Het
Slc33a1 T A 3: 63,953,906 T292S probably benign Het
Slc5a11 A G 7: 123,238,155 K56R probably benign Het
Slc7a13 G A 4: 19,839,534 G379E probably damaging Het
Specc1l A G 10: 75,246,549 E593G probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Vipr1 A G 9: 121,669,565 *460W probably null Het
Zbtb18 T A 1: 177,448,043 L323Q probably damaging Het
Zfyve1 A G 12: 83,594,496 S129P probably benign Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 synonymous probably null
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
R7838:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9717563 missense probably damaging 1.00
R7921:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7937:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7938:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7972:Spef2 UTSW 15 9717563 missense probably damaging 1.00
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACCTAGTTTAGCAGTGAAATG -3'
(R):5'- CCTAAAGAATTCCTCTAGTTCCTCG -3'

Sequencing Primer
(F):5'- CTACTTCTTTCAGGAAAATTAGTCCC -3'
(R):5'- AGTTCCTCGAATATCCAATTCTCCAG -3'
Posted On2018-06-22