Incidental Mutation 'R6609:Olfr522'
ID525828
Institutional Source Beutler Lab
Gene Symbol Olfr522
Ensembl Gene ENSMUSG00000051180
Gene Nameolfactory receptor 522
SynonymsMOR103-5, GA_x6K02T2PBJ9-42315125-42314187
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6609 (G1)
Quality Score177.009
Status Validated
Chromosome7
Chromosomal Location140159999-140164764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 140162563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 129 (R129L)
Ref Sequence ENSEMBL: ENSMUSP00000057288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050585]
Predicted Effect probably benign
Transcript: ENSMUST00000050585
AA Change: R129L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057288
Gene: ENSMUSG00000051180
AA Change: R129L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.7e-54 PFAM
Pfam:7tm_1 42 291 1.2e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,928,762 V421I probably damaging Het
Bpifb3 T A 2: 153,920,648 probably null Het
C1rl T C 6: 124,508,624 V318A probably benign Het
Cacna1b C T 2: 24,653,049 V1264M probably damaging Het
Cacna1s A G 1: 136,113,391 D1551G probably benign Het
Cdc42bpa T G 1: 180,101,274 probably null Het
Cdc7 G A 5: 106,973,058 R182H probably benign Het
Cyth1 A T 11: 118,170,860 L309Q probably damaging Het
Dnah6 G A 6: 73,053,695 T3378I possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Get4 A G 5: 139,269,065 probably benign Het
Gm136 T A 4: 34,746,526 M162L probably benign Het
Grik5 G T 7: 25,015,526 S681* probably null Het
Hsf5 C T 11: 87,635,953 P484S probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kl A T 5: 150,988,962 K725N probably benign Het
Lama3 G A 18: 12,513,678 V144M probably damaging Het
Lrrc14 T C 15: 76,714,253 V363A probably benign Het
Mettl15 T C 2: 109,137,342 R200G probably null Het
Mki67 T C 7: 135,699,829 T1159A possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ndufb5 C G 3: 32,741,683 T8R probably benign Het
Olfr1313 T C 2: 112,072,164 M140V probably benign Het
Pde1a T A 2: 79,906,140 D15V probably damaging Het
Plcg2 G A 8: 117,568,170 G191S probably benign Het
Ptprq T C 10: 107,572,968 T1895A probably damaging Het
Pxdn T C 12: 30,002,941 V1039A probably benign Het
Slc26a5 T C 5: 21,819,719 I456V possibly damaging Het
Smco4 C T 9: 15,544,735 A39V probably damaging Het
Tmem102 T A 11: 69,805,114 L40F probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zfp985 A T 4: 147,583,121 M149L probably benign Het
Zfp985 T C 4: 147,583,667 F331L probably damaging Het
Other mutations in Olfr522
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Olfr522 APN 7 140162928 missense probably benign 0.01
IGL02121:Olfr522 APN 7 140162694 missense probably benign 0.10
IGL02399:Olfr522 APN 7 140162600 missense probably benign
IGL02803:Olfr522 APN 7 140162374 missense possibly damaging 0.92
R0446:Olfr522 UTSW 7 140162471 missense probably damaging 1.00
R0538:Olfr522 UTSW 7 140162231 missense probably damaging 1.00
R0707:Olfr522 UTSW 7 140162089 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1584:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1893:Olfr522 UTSW 7 140162821 missense probably damaging 1.00
R1895:Olfr522 UTSW 7 140162813 missense possibly damaging 0.82
R2004:Olfr522 UTSW 7 140162816 missense probably damaging 0.98
R2060:Olfr522 UTSW 7 140162824 missense probably damaging 1.00
R2067:Olfr522 UTSW 7 140162909 missense possibly damaging 0.69
R4841:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4842:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4956:Olfr522 UTSW 7 140162080 missense possibly damaging 0.70
R5189:Olfr522 UTSW 7 140162719 missense probably damaging 0.98
R5325:Olfr522 UTSW 7 140162113 missense probably damaging 1.00
R5441:Olfr522 UTSW 7 140162651 missense probably benign 0.36
R5618:Olfr522 UTSW 7 140162272 missense probably damaging 1.00
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R7154:Olfr522 UTSW 7 140162084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCATTTCAATGGCAGTGGTG -3'
(R):5'- AATCTGTCTGTGCTCGAGACC -3'

Sequencing Primer
(F):5'- CAGTGGTGTCTGTGCAGGAC -3'
(R):5'- GTGCTCGAGACCCTCTACAC -3'
Posted On2018-06-22