Incidental Mutation 'R6642:Gins1'
ID525831
Institutional Source Beutler Lab
Gene Symbol Gins1
Ensembl Gene ENSMUSG00000027454
Gene NameGINS complex subunit 1 (Psf1 homolog)
SynonymsPsf1, 2810418N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150905400-150931280 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 150928118 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028948]
Predicted Effect probably null
Transcript: ENSMUST00000028948
SMART Domains Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454

DomainStartEndE-ValueType
PDB:2Q9Q|G 1 196 1e-141 PDB
Blast:KISc 112 188 3e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152991
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele display disorganized embryonic and extraembryonic structures and fail to develop past E5.5; mutant blastocysts fail to exhibit outgrowth in culture and show a cell proliferation defect and inner cell mass apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Gins1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1352:Gins1 UTSW 2 150930848 nonsense probably null
R1575:Gins1 UTSW 2 150912838 missense probably benign
R4361:Gins1 UTSW 2 150925901 missense probably damaging 1.00
R4362:Gins1 UTSW 2 150909762 missense probably damaging 1.00
R4618:Gins1 UTSW 2 150917861 splice site probably null
R5769:Gins1 UTSW 2 150925998 missense probably damaging 0.99
R6700:Gins1 UTSW 2 150916228 missense probably damaging 1.00
R7038:Gins1 UTSW 2 150917871 missense probably damaging 1.00
R7072:Gins1 UTSW 2 150909751 splice site probably null
R7325:Gins1 UTSW 2 150916166 missense probably benign
R8458:Gins1 UTSW 2 150930887 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCTGTGTCCTGTTCACATACTG -3'
(R):5'- GCTATCAAAACCAGCATTTCCATG -3'

Sequencing Primer
(F):5'- AGCTATACTGTCAGTCAGGAAGCTG -3'
(R):5'- CCTAGACAGGGTTTCTCTGTGTAGC -3'
Posted On2018-06-22