Incidental Mutation 'R6609:Kcnc2'
ID525838
Institutional Source Beutler Lab
Gene Symbol Kcnc2
Ensembl Gene ENSMUSG00000035681
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 2
SynonymsKv3.2, KShIIIA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6609 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location112271121-112467024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 112271856 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 51 (G51R)
Ref Sequence ENSEMBL: ENSMUSP00000151579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092175] [ENSMUST00000219301]
Predicted Effect probably benign
Transcript: ENSMUST00000092175
AA Change: G51R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000089814
Gene: ENSMUSG00000035681
AA Change: G51R

DomainStartEndE-ValueType
BTB 8 163 2.53e-17 SMART
Pfam:Ion_trans 232 488 1e-46 PFAM
Pfam:Ion_trans_2 388 481 5.8e-13 PFAM
low complexity region 552 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219301
AA Change: G51R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.1030 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired fast spiking in cortical interneurons, distorted cortical rhythmic activity, enhanced susceptibility to seizures, increased anxiety in the open field, and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 C T 12: 118,928,762 V421I probably damaging Het
Bpifb3 T A 2: 153,920,648 probably null Het
C1rl T C 6: 124,508,624 V318A probably benign Het
Cacna1b C T 2: 24,653,049 V1264M probably damaging Het
Cacna1s A G 1: 136,113,391 D1551G probably benign Het
Cdc42bpa T G 1: 180,101,274 probably null Het
Cdc7 G A 5: 106,973,058 R182H probably benign Het
Cyth1 A T 11: 118,170,860 L309Q probably damaging Het
Dnah6 G A 6: 73,053,695 T3378I possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Get4 A G 5: 139,269,065 probably benign Het
Gm136 T A 4: 34,746,526 M162L probably benign Het
Grik5 G T 7: 25,015,526 S681* probably null Het
Hsf5 C T 11: 87,635,953 P484S probably damaging Het
Kl A T 5: 150,988,962 K725N probably benign Het
Lama3 G A 18: 12,513,678 V144M probably damaging Het
Lrrc14 T C 15: 76,714,253 V363A probably benign Het
Mettl15 T C 2: 109,137,342 R200G probably null Het
Mki67 T C 7: 135,699,829 T1159A possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ndufb5 C G 3: 32,741,683 T8R probably benign Het
Olfr1313 T C 2: 112,072,164 M140V probably benign Het
Olfr522 C A 7: 140,162,563 R129L probably benign Het
Pde1a T A 2: 79,906,140 D15V probably damaging Het
Plcg2 G A 8: 117,568,170 G191S probably benign Het
Ptprq T C 10: 107,572,968 T1895A probably damaging Het
Pxdn T C 12: 30,002,941 V1039A probably benign Het
Slc26a5 T C 5: 21,819,719 I456V possibly damaging Het
Smco4 C T 9: 15,544,735 A39V probably damaging Het
Tmem102 T A 11: 69,805,114 L40F probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Zfp985 A T 4: 147,583,121 M149L probably benign Het
Zfp985 T C 4: 147,583,667 F331L probably damaging Het
Other mutations in Kcnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnc2 APN 10 112461988 missense probably damaging 0.99
IGL00595:Kcnc2 APN 10 112461987 missense probably benign 0.04
IGL01646:Kcnc2 APN 10 112272406 critical splice donor site probably null
IGL01950:Kcnc2 APN 10 112462075 intron probably benign
IGL02036:Kcnc2 APN 10 112455926 missense possibly damaging 0.94
IGL02164:Kcnc2 APN 10 112455685 missense possibly damaging 0.92
IGL02447:Kcnc2 APN 10 112455946 missense probably damaging 1.00
IGL03087:Kcnc2 APN 10 112455747 missense probably benign 0.19
IGL03385:Kcnc2 APN 10 112455786 missense probably damaging 1.00
R0133:Kcnc2 UTSW 10 112458597 missense probably damaging 1.00
R1444:Kcnc2 UTSW 10 112455601 unclassified probably benign
R1474:Kcnc2 UTSW 10 112456400 missense probably damaging 1.00
R2221:Kcnc2 UTSW 10 112456526 missense probably damaging 1.00
R4504:Kcnc2 UTSW 10 112455794 missense probably damaging 1.00
R4714:Kcnc2 UTSW 10 112455828 missense possibly damaging 0.82
R4935:Kcnc2 UTSW 10 112272228 missense probably benign 0.00
R6168:Kcnc2 UTSW 10 112455756 missense probably benign 0.13
R6338:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6375:Kcnc2 UTSW 10 112463189 missense possibly damaging 0.92
R6511:Kcnc2 UTSW 10 112462067 intron probably benign
R6516:Kcnc2 UTSW 10 112462000 missense probably benign 0.00
R6556:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6610:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6612:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6837:Kcnc2 UTSW 10 112458502 missense probably damaging 0.96
R7151:Kcnc2 UTSW 10 112458509 missense possibly damaging 0.46
R7715:Kcnc2 UTSW 10 112271940 nonsense probably null
Z1177:Kcnc2 UTSW 10 112272306 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAGTCATGTCTGAGCCAC -3'
(R):5'- TGCCCGTGCGGTAGTAATTG -3'

Sequencing Primer
(F):5'- CCACAGAGATGGGCAAGATC -3'
(R):5'- TTGAGCACATAGGCGAATACTCCTG -3'
Posted On2018-06-22