Incidental Mutation 'R6642:Fzd1'
ID525839
Institutional Source Beutler Lab
Gene Symbol Fzd1
Ensembl Gene ENSMUSG00000044674
Gene Namefrizzled class receptor 1
SynonymsFZ-1, Fz1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location4753839-4758035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4755696 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 629 (Y629H)
Ref Sequence ENSEMBL: ENSMUSP00000058629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054294]
Predicted Effect probably damaging
Transcript: ENSMUST00000054294
AA Change: Y629H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058629
Gene: ENSMUSG00000044674
AA Change: Y629H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 71 96 N/A INTRINSIC
FRI 110 227 7.77e-72 SMART
low complexity region 249 262 N/A INTRINSIC
Frizzled 304 635 4.18e-224 SMART
Meta Mutation Damage Score 0.2484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD1 protein contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. The FZD1 transcript is expressed in various tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Fzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Fzd1 APN 5 4756037 missense probably benign 0.11
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0402:Fzd1 UTSW 5 4755702 missense possibly damaging 0.46
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1585:Fzd1 UTSW 5 4756278 missense probably damaging 1.00
R1606:Fzd1 UTSW 5 4757514 nonsense probably null
R1708:Fzd1 UTSW 5 4755791 missense possibly damaging 0.82
R1767:Fzd1 UTSW 5 4756812 missense probably benign
R1803:Fzd1 UTSW 5 4756385 missense probably damaging 0.97
R1909:Fzd1 UTSW 5 4757481 missense probably benign 0.01
R2990:Fzd1 UTSW 5 4755758 missense probably damaging 0.98
R4446:Fzd1 UTSW 5 4755777 missense probably damaging 1.00
R4631:Fzd1 UTSW 5 4755865 nonsense probably null
R4632:Fzd1 UTSW 5 4755865 nonsense probably null
R4633:Fzd1 UTSW 5 4755865 nonsense probably null
R5110:Fzd1 UTSW 5 4756448 missense probably benign 0.00
R6406:Fzd1 UTSW 5 4756089 missense probably damaging 1.00
R6489:Fzd1 UTSW 5 4757336 missense probably benign 0.33
R7095:Fzd1 UTSW 5 4755824 small deletion probably benign
R7150:Fzd1 UTSW 5 4756145 missense probably benign 0.14
R7204:Fzd1 UTSW 5 4755980 missense probably damaging 1.00
R8290:Fzd1 UTSW 5 4757060 missense possibly damaging 0.90
R8354:Fzd1 UTSW 5 4757336 missense probably benign 0.18
R8454:Fzd1 UTSW 5 4757336 missense probably benign 0.18
X0028:Fzd1 UTSW 5 4756958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAAAAGTCAGTGGCTG -3'
(R):5'- CTATGAACAGGCCTTTCGGG -3'

Sequencing Primer
(F):5'- AGTCAGTGGCTGGCGAG -3'
(R):5'- GCTGCAAGAGTTATGCCATC -3'
Posted On2018-06-22