Incidental Mutation 'R6642:Rundc3b'
ID525841
Institutional Source Beutler Lab
Gene Symbol Rundc3b
Ensembl Gene ENSMUSG00000040570
Gene NameRUN domain containing 3B
SynonymsLOC242819
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.609) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8490334-8622952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8579071 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 110 (I110N)
Ref Sequence ENSEMBL: ENSMUSP00000111036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047485] [ENSMUST00000115378]
Predicted Effect probably damaging
Transcript: ENSMUST00000047485
AA Change: I110N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040108
Gene: ENSMUSG00000040570
AA Change: I110N

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115378
AA Change: I110N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111036
Gene: ENSMUSG00000040570
AA Change: I110N

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
RUN 126 188 3.28e-23 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 270 278 N/A INTRINSIC
Meta Mutation Damage Score 0.4049 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Rundc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rundc3b APN 5 8569553 missense probably damaging 0.98
IGL01726:Rundc3b APN 5 8520902 missense probably benign 0.24
IGL02271:Rundc3b APN 5 8492530 missense probably damaging 1.00
IGL03394:Rundc3b APN 5 8548261 missense possibly damaging 0.93
F5770:Rundc3b UTSW 5 8622549 small deletion probably benign
R0656:Rundc3b UTSW 5 8569529 missense probably damaging 1.00
R1702:Rundc3b UTSW 5 8512318 missense probably benign
R1776:Rundc3b UTSW 5 8579050 missense probably damaging 1.00
R1829:Rundc3b UTSW 5 8579117 missense probably damaging 1.00
R2011:Rundc3b UTSW 5 8512409 critical splice acceptor site probably null
R3606:Rundc3b UTSW 5 8512386 missense probably damaging 1.00
R4841:Rundc3b UTSW 5 8528742 missense probably damaging 1.00
R6452:Rundc3b UTSW 5 8579175 splice site probably null
R7022:Rundc3b UTSW 5 8512348 missense probably null 0.00
R7187:Rundc3b UTSW 5 8492506 missense probably damaging 1.00
R7310:Rundc3b UTSW 5 8521011 nonsense probably null
R7391:Rundc3b UTSW 5 8559455 missense probably benign 0.00
V7582:Rundc3b UTSW 5 8622549 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAACAGTGGTCATTCAAC -3'
(R):5'- AGCTAGAGGAGGGCTTACTG -3'

Sequencing Primer
(F):5'- CCTCTAAAGGATGTCAACAACTTGGG -3'
(R):5'- CTAGAGGAGGGCTTACTGTTCTTGC -3'
Posted On2018-06-22