Incidental Mutation 'R6642:Nod1'
ID525843
Institutional Source Beutler Lab
Gene Symbol Nod1
Ensembl Gene ENSMUSG00000038058
Gene Namenucleotide-binding oligomerization domain containing 1
SynonymsCard4, F830007N14Rik, Nlrc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location54923949-54972612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54948029 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 99 (D99A)
Ref Sequence ENSEMBL: ENSMUSP00000130487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060655] [ENSMUST00000168172] [ENSMUST00000203076] [ENSMUST00000203837]
Predicted Effect probably damaging
Transcript: ENSMUST00000060655
AA Change: D99A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055747
Gene: ENSMUSG00000038058
AA Change: D99A

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 4.7e-21 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 1.3e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168172
AA Change: D99A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130487
Gene: ENSMUSG00000038058
AA Change: D99A

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
Pfam:CARD 20 105 7.6e-20 PFAM
low complexity region 174 185 N/A INTRINSIC
Pfam:NACHT 196 368 6.2e-41 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 555 565 N/A INTRINSIC
low complexity region 708 717 N/A INTRINSIC
LRR 727 754 1.25e0 SMART
LRR 755 782 1.22e1 SMART
LRR 783 810 1.96e2 SMART
LRR 811 838 1.08e-1 SMART
LRR 839 866 3.95e-4 SMART
LRR 867 894 1.51e0 SMART
LRR 895 922 7.15e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203076
SMART Domains Protein: ENSMUSP00000145123
Gene: ENSMUSG00000038058

DomainStartEndE-ValueType
low complexity region 82 91 N/A INTRINSIC
LRR 101 128 5.3e-3 SMART
LRR 157 184 4.8e-4 SMART
LRR 185 212 1.7e-6 SMART
LRR 213 240 6.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203837
SMART Domains Protein: ENSMUSP00000145005
Gene: ENSMUSG00000038058

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
PDB:2NZ7|B 13 52 4e-14 PDB
Blast:CARD 17 52 1e-14 BLAST
Meta Mutation Damage Score 0.4966 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOD (nucleotide-binding oligomerization domain) family. This member is a cytosolic protein. It contains an N-terminal caspase recruitment domain (CARD), a centrally located nucleotide-binding domain (NBD), and 10 tandem leucine-rich repeats (LRRs) in its C terminus. The CARD is involved in apoptotic signaling, LRRs participate in protein-protein interactions, and mutations in the NBD may affect the process of oligomerization and subsequent function of the LRR domain. This protein is an intracellular pattern-recognition receptor (PRR) that initiates inflammation in response to a subset of bacteria through the detection of bacterial diaminopimelic acid. Multiple alternatively spliced transcript variants differring in the 5' UTR have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice were viable, fertile, and appeared normal in a specific-pathogen free environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Nod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Nod1 APN 6 54944946 missense probably damaging 1.00
IGL00937:Nod1 APN 6 54937364 missense probably benign 0.08
IGL00945:Nod1 APN 6 54944586 splice site probably null
IGL01410:Nod1 APN 6 54944356 missense probably damaging 1.00
IGL02094:Nod1 APN 6 54939390 splice site probably null
IGL02217:Nod1 APN 6 54943419 missense possibly damaging 0.63
IGL02573:Nod1 APN 6 54943945 missense probably benign 0.02
IGL02944:Nod1 APN 6 54924947 missense possibly damaging 0.68
R0092:Nod1 UTSW 6 54944541 missense probably damaging 1.00
R0108:Nod1 UTSW 6 54943749 missense probably benign 0.27
R0148:Nod1 UTSW 6 54938217 missense probably damaging 1.00
R0771:Nod1 UTSW 6 54944269 missense probably damaging 0.96
R1493:Nod1 UTSW 6 54944056 missense probably damaging 1.00
R1540:Nod1 UTSW 6 54943975 missense probably benign 0.09
R1660:Nod1 UTSW 6 54944233 splice site probably null
R1710:Nod1 UTSW 6 54944059 missense probably damaging 0.98
R1911:Nod1 UTSW 6 54944440 missense probably damaging 0.96
R2008:Nod1 UTSW 6 54939325 missense probably damaging 1.00
R3409:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3410:Nod1 UTSW 6 54944917 missense probably benign 0.01
R3927:Nod1 UTSW 6 54944917 missense probably benign 0.01
R4499:Nod1 UTSW 6 54943996 missense probably damaging 1.00
R4608:Nod1 UTSW 6 54943756 missense probably damaging 1.00
R5552:Nod1 UTSW 6 54944631 missense probably damaging 1.00
R5667:Nod1 UTSW 6 54933576 missense probably benign 0.06
R5859:Nod1 UTSW 6 54930177 missense probably benign 0.08
R5868:Nod1 UTSW 6 54939327 missense probably damaging 1.00
R5995:Nod1 UTSW 6 54944554 missense probably damaging 0.99
R6329:Nod1 UTSW 6 54944704 missense probably benign 0.00
R6331:Nod1 UTSW 6 54924983 missense probably damaging 1.00
R6798:Nod1 UTSW 6 54944611 missense probably damaging 0.97
R6889:Nod1 UTSW 6 54944109 missense probably benign 0.27
R7582:Nod1 UTSW 6 54944307 missense probably damaging 1.00
R8123:Nod1 UTSW 6 54937406 missense probably damaging 1.00
R8317:Nod1 UTSW 6 54943440 missense probably damaging 1.00
R8338:Nod1 UTSW 6 54943971 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTGATGTCAGGGACCATCTCTTC -3'
(R):5'- TGCACCAGGATCCTTTTGAC -3'

Sequencing Primer
(F):5'- AGGGACCATCTCTTCTTTCCAAAATG -3'
(R):5'- CACCAGGATCCTTTTGACAGGAAG -3'
Posted On2018-06-22