Incidental Mutation 'R6642:Il16'
ID525845
Institutional Source Beutler Lab
Gene Symbol Il16
Ensembl Gene ENSMUSG00000001741
Gene Nameinterleukin 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location83642825-83745726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83688127 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 127 (F127L)
Ref Sequence ENSEMBL: ENSMUSP00000118516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001792] [ENSMUST00000153560]
Predicted Effect probably benign
Transcript: ENSMUST00000001792
AA Change: F127L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001792
Gene: ENSMUSG00000001741
AA Change: F127L

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
PDZ 222 300 6.5e-23 SMART
PDZ 361 438 3.89e-12 SMART
low complexity region 507 526 N/A INTRINSIC
low complexity region 556 577 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 647 680 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 825 839 N/A INTRINSIC
low complexity region 978 989 N/A INTRINSIC
PDZ 1115 1192 3.6e-16 SMART
low complexity region 1201 1216 N/A INTRINSIC
PDZ 1234 1310 4.11e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153560
AA Change: F127L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118516
Gene: ENSMUSG00000001741
AA Change: F127L

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 99 115 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display a transient but consistent increase of thymidine incorporation in anti-CD3-stimulated CD4+ T cells, but fail to show a hyperproliferative T cell phenotype using BrdU labeling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Il16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Il16 APN 7 83652458 missense probably benign 0.02
IGL01743:Il16 APN 7 83652299 missense probably benign 0.00
IGL01770:Il16 APN 7 83673026 splice site probably benign
IGL02025:Il16 APN 7 83652848 missense probably damaging 1.00
IGL02317:Il16 APN 7 83666889 missense probably damaging 1.00
IGL02412:Il16 APN 7 83652691 missense probably benign 0.03
IGL02550:Il16 APN 7 83674496 missense possibly damaging 0.90
IGL02568:Il16 APN 7 83661276 missense probably damaging 1.00
IGL02578:Il16 APN 7 83677986 critical splice donor site probably null
IGL02815:Il16 APN 7 83651041 missense probably damaging 0.98
IGL03157:Il16 APN 7 83722403 missense probably damaging 1.00
IGL03161:Il16 APN 7 83722499 missense probably damaging 1.00
IGL03188:Il16 APN 7 83688163 missense probably benign 0.00
IGL03213:Il16 APN 7 83646500 missense probably damaging 1.00
IGL03274:Il16 APN 7 83661234 missense probably damaging 1.00
R0201:Il16 UTSW 7 83722308 missense probably damaging 0.99
R0309:Il16 UTSW 7 83722554 missense probably damaging 1.00
R0597:Il16 UTSW 7 83677975 splice site probably benign
R0942:Il16 UTSW 7 83663141 missense probably benign 0.01
R1018:Il16 UTSW 7 83674538 missense probably damaging 1.00
R1434:Il16 UTSW 7 83655312 missense probably benign
R1715:Il16 UTSW 7 83648728 missense probably benign 0.01
R2179:Il16 UTSW 7 83688079 splice site probably null
R2520:Il16 UTSW 7 83651994 missense probably benign 0.03
R3425:Il16 UTSW 7 83644040 missense probably damaging 1.00
R3761:Il16 UTSW 7 83650885 missense possibly damaging 0.96
R3943:Il16 UTSW 7 83652015 missense probably damaging 0.97
R4470:Il16 UTSW 7 83650838 intron probably benign
R4530:Il16 UTSW 7 83681310 intron probably benign
R4583:Il16 UTSW 7 83682899 missense probably damaging 1.00
R4777:Il16 UTSW 7 83650896 missense probably benign 0.14
R4874:Il16 UTSW 7 83660945 missense possibly damaging 0.56
R4876:Il16 UTSW 7 83673094 missense probably benign
R5677:Il16 UTSW 7 83674553 missense probably damaging 1.00
R5686:Il16 UTSW 7 83648728 missense probably benign 0.36
R5920:Il16 UTSW 7 83652344 missense probably benign 0.03
R6115:Il16 UTSW 7 83652567 nonsense probably null
R6459:Il16 UTSW 7 83722321 missense probably damaging 1.00
R6459:Il16 UTSW 7 83722328 missense probably damaging 1.00
R6601:Il16 UTSW 7 83722469 missense probably damaging 1.00
R6616:Il16 UTSW 7 83646476 missense probably benign 0.37
R6721:Il16 UTSW 7 83663062 critical splice donor site probably null
R7009:Il16 UTSW 7 83646388 missense probably benign
R7144:Il16 UTSW 7 83646451 missense probably damaging 0.97
R7346:Il16 UTSW 7 83644041 missense probably damaging 1.00
R7403:Il16 UTSW 7 83670135 missense probably damaging 1.00
R7499:Il16 UTSW 7 83674494 missense probably damaging 0.99
R7814:Il16 UTSW 7 83670140 missense possibly damaging 0.46
R7941:Il16 UTSW 7 83682829 missense probably damaging 0.98
R8098:Il16 UTSW 7 83646559 missense probably damaging 1.00
R8317:Il16 UTSW 7 83655330 missense probably benign
R8437:Il16 UTSW 7 83652143 missense probably damaging 1.00
Z1176:Il16 UTSW 7 83652827 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TAATCTCCCTCACAGCACTGG -3'
(R):5'- GGCAAATCAACAAGTATTTCTCTGG -3'

Sequencing Primer
(F):5'- AATCCATAGGTCTCCAGGTGATG -3'
(R):5'- AGTATTTCTCTGGTCCATGCCAACAG -3'
Posted On2018-06-22