Incidental Mutation 'R6642:Tmc7'
ID525852
Institutional Source Beutler Lab
Gene Symbol Tmc7
Ensembl Gene ENSMUSG00000042246
Gene Nametransmembrane channel-like gene family 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118535841-118584736 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 118545611 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 575 (Y575*)
Ref Sequence ENSEMBL: ENSMUSP00000046927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044195]
Predicted Effect probably null
Transcript: ENSMUST00000044195
AA Change: Y575*
SMART Domains Protein: ENSMUSP00000046927
Gene: ENSMUSG00000042246
AA Change: Y575*

DomainStartEndE-ValueType
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 216 238 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 402 424 N/A INTRINSIC
Pfam:TMC 484 595 5.2e-51 PFAM
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153635
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Tmc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Tmc7 APN 7 118552762 missense probably damaging 1.00
IGL01456:Tmc7 APN 7 118547310 splice site probably benign
IGL01784:Tmc7 APN 7 118547315 critical splice donor site probably null
IGL02158:Tmc7 APN 7 118538211 missense probably damaging 1.00
PIT4403001:Tmc7 UTSW 7 118547400 missense probably benign 0.04
PIT4403001:Tmc7 UTSW 7 118547401 missense possibly damaging 0.86
PIT4696001:Tmc7 UTSW 7 118564343 missense probably benign 0.04
R1164:Tmc7 UTSW 7 118542024 missense probably benign 0.01
R1169:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1170:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1420:Tmc7 UTSW 7 118566217 nonsense probably null
R1885:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1886:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1887:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1923:Tmc7 UTSW 7 118545627 missense probably benign 0.08
R2220:Tmc7 UTSW 7 118552816 missense possibly damaging 0.87
R4858:Tmc7 UTSW 7 118543342 missense probably damaging 1.00
R5000:Tmc7 UTSW 7 118558854 critical splice donor site probably null
R5038:Tmc7 UTSW 7 118543365 missense probably damaging 1.00
R5075:Tmc7 UTSW 7 118552696 critical splice donor site probably null
R5272:Tmc7 UTSW 7 118561053 missense probably benign
R5691:Tmc7 UTSW 7 118541893 missense probably benign
R5800:Tmc7 UTSW 7 118539440 missense probably benign
R5889:Tmc7 UTSW 7 118566326 missense probably benign 0.00
R5939:Tmc7 UTSW 7 118545727 missense probably benign 0.33
R6251:Tmc7 UTSW 7 118561038 missense possibly damaging 0.83
R6644:Tmc7 UTSW 7 118538162 missense probably benign
R6814:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6872:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6967:Tmc7 UTSW 7 118547678 missense probably benign 0.00
R7165:Tmc7 UTSW 7 118555934 missense probably benign 0.00
R7492:Tmc7 UTSW 7 118541966 missense probably benign 0.00
R7543:Tmc7 UTSW 7 118545756 missense probably benign 0.01
R8048:Tmc7 UTSW 7 118566245 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAGTCCCTTCCCAGAATATATTC -3'
(R):5'- CCTACTGTGCCTCCTCAAAG -3'

Sequencing Primer
(F):5'- TTCATATTAAGGAAGCCCTGGG -3'
(R):5'- TCAAAGCTGATCCAGTGCTG -3'
Posted On2018-06-22