Incidental Mutation 'R6642:Aldh1a2'
ID525854
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71252986 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 98 (D98V)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect probably damaging
Transcript: ENSMUST00000034723
AA Change: D98V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: D98V

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1737:Aldh1a2 UTSW 9 71285171 missense possibly damaging 0.56
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTTGATGACAGCATGTAGGGC -3'
(R):5'- GAGCTTCCCTAAAGACCTCTC -3'

Sequencing Primer
(F):5'- ACAGCATGTAGGGCTTGTG -3'
(R):5'- CCTAAAGACCTCTCATATTTTGTGTG -3'
Posted On2018-06-22