Incidental Mutation 'R6642:Xylb'
ID525857
Institutional Source Beutler Lab
Gene Symbol Xylb
Ensembl Gene ENSMUSG00000035769
Gene Namexylulokinase homolog (H. influenzae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6642 (G1)
Quality Score170.009
Status Validated
Chromosome9
Chromosomal Location119357381-119393797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119367493 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 114 (H114R)
Ref Sequence ENSEMBL: ENSMUSP00000047254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039610] [ENSMUST00000170400] [ENSMUST00000215822] [ENSMUST00000216838]
Predicted Effect probably damaging
Transcript: ENSMUST00000039610
AA Change: H114R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047254
Gene: ENSMUSG00000035769
AA Change: H114R

DomainStartEndE-ValueType
low complexity region 123 142 N/A INTRINSIC
Pfam:FGGY_N 144 302 3.9e-15 PFAM
Pfam:FGGY_C 310 496 2.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170400
SMART Domains Protein: ENSMUSP00000131982
Gene: ENSMUSG00000070280

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Sugar_tr 150 555 1.2e-28 PFAM
Pfam:MFS_1 178 514 7.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215822
Predicted Effect probably benign
Transcript: ENSMUST00000216838
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Xylb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Xylb APN 9 119390483 nonsense probably null
R0330:Xylb UTSW 9 119381587 missense probably damaging 0.98
R0959:Xylb UTSW 9 119380025 missense possibly damaging 0.85
R1127:Xylb UTSW 9 119383377 missense probably damaging 0.99
R1401:Xylb UTSW 9 119368067 splice site probably benign
R1417:Xylb UTSW 9 119364540 missense probably benign 0.04
R2315:Xylb UTSW 9 119359269 missense probably benign 0.22
R2322:Xylb UTSW 9 119388747 missense possibly damaging 0.95
R3884:Xylb UTSW 9 119380687 missense probably damaging 1.00
R4367:Xylb UTSW 9 119388715 missense probably benign 0.10
R4463:Xylb UTSW 9 119386367 missense probably benign 0.00
R4750:Xylb UTSW 9 119359313 nonsense probably null
R5181:Xylb UTSW 9 119364501 missense probably damaging 1.00
R5568:Xylb UTSW 9 119361132 missense probably benign 0.43
R6104:Xylb UTSW 9 119364507 makesense probably null
R6171:Xylb UTSW 9 119381591 missense probably damaging 1.00
R6643:Xylb UTSW 9 119367493 missense probably damaging 1.00
R6836:Xylb UTSW 9 119391754 missense probably damaging 1.00
R7121:Xylb UTSW 9 119382292 missense probably benign 0.00
R7496:Xylb UTSW 9 119391816 makesense probably null
R7776:Xylb UTSW 9 119380700 critical splice donor site probably null
R7908:Xylb UTSW 9 119381545 missense probably benign 0.00
R7989:Xylb UTSW 9 119381545 missense probably benign 0.00
R8025:Xylb UTSW 9 119381503 missense probably damaging 0.99
Z1088:Xylb UTSW 9 119381614 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGACAGGGTGCAGTTCCTTC -3'
(R):5'- CCTTCTCACACTGCAGAGAAG -3'

Sequencing Primer
(F):5'- CACAAAGACACTGAGTTATGTGAC -3'
(R):5'- CTGCAGAGAAGCCCCAGAG -3'
Posted On2018-06-22