Incidental Mutation 'R6642:Olfr807'
ID525865
Institutional Source Beutler Lab
Gene Symbol Olfr807
Ensembl Gene ENSMUSG00000050478
Gene Nameolfactory receptor 807
SynonymsMOR117-1, GA_x6K02T2PULF-11434134-11433199
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129754092-129757793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129755363 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 29 (L29Q)
Ref Sequence ENSEMBL: ENSMUSP00000150657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059038] [ENSMUST00000213379] [ENSMUST00000217106]
Predicted Effect probably damaging
Transcript: ENSMUST00000059038
AA Change: L29Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049924
Gene: ENSMUSG00000050478
AA Change: L29Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 3.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 302 3.4e-8 PFAM
Pfam:7tm_1 39 296 2.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213379
AA Change: L29Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217106
AA Change: L29Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Olfr807
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02586:Olfr807 APN 10 129754655 missense possibly damaging 0.87
IGL03031:Olfr807 APN 10 129755369 missense possibly damaging 0.94
R0691:Olfr807 UTSW 10 129755402 missense probably damaging 1.00
R0848:Olfr807 UTSW 10 129755208 missense probably benign 0.00
R0988:Olfr807 UTSW 10 129754997 missense probably benign 0.03
R1880:Olfr807 UTSW 10 129755421 missense probably benign 0.09
R1894:Olfr807 UTSW 10 129755074 nonsense probably null
R1935:Olfr807 UTSW 10 129754715 missense probably damaging 1.00
R2513:Olfr807 UTSW 10 129755152 missense probably damaging 1.00
R4201:Olfr807 UTSW 10 129754628 missense probably damaging 1.00
R4643:Olfr807 UTSW 10 129754955 missense probably damaging 1.00
R4651:Olfr807 UTSW 10 129755418 missense probably benign
R4652:Olfr807 UTSW 10 129755418 missense probably benign
R4797:Olfr807 UTSW 10 129754521 missense probably benign 0.06
R5337:Olfr807 UTSW 10 129754534 nonsense probably null
R5597:Olfr807 UTSW 10 129754886 missense probably damaging 1.00
R6310:Olfr807 UTSW 10 129754659 missense probably benign 0.04
R6442:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R6443:Olfr807 UTSW 10 129755408 missense probably damaging 1.00
R7660:Olfr807 UTSW 10 129754563 nonsense probably null
R7862:Olfr807 UTSW 10 129755355 missense probably benign 0.00
Z1088:Olfr807 UTSW 10 129755339 missense possibly damaging 0.77
Z1176:Olfr807 UTSW 10 129754688 missense probably damaging 1.00
Z1176:Olfr807 UTSW 10 129754824 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTATCCATGGTCACTATGCTGACC -3'
(R):5'- CTTAGCAGGAAACAAAACCTTCTG -3'

Sequencing Primer
(F):5'- TGGTCACTATGCTGACCAGGAAC -3'
(R):5'- GTATTGCAGGATTCTTCATACCAC -3'
Posted On2018-06-22