Incidental Mutation 'R6610:Setdb1'
ID525872
Institutional Source Beutler Lab
Gene Symbol Setdb1
Ensembl Gene ENSMUSG00000015697
Gene NameSET domain, bifurcated 1
SynonymsKMT1E, ESET
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6610 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95323525-95357202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95328577 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 841 (A841D)
Ref Sequence ENSEMBL: ENSMUSP00000102789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171]
Predicted Effect probably damaging
Transcript: ENSMUST00000015841
AA Change: A842D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697
AA Change: A842D

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000015858
SMART Domains Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

DomainStartEndE-ValueType
transmembrane domain 46 68 N/A INTRINSIC
HOX 71 132 3.08e-2 SMART
TLC 131 332 1.17e-81 SMART
low complexity region 337 360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107170
AA Change: A842D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697
AA Change: A842D

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107171
AA Change: A841D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697
AA Change: A841D

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124638
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Stk32b G A 5: 37,448,678 T407I probably benign Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Setdb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Setdb1 APN 3 95338577 missense probably damaging 1.00
IGL00915:Setdb1 APN 3 95346788 missense probably damaging 1.00
IGL01339:Setdb1 APN 3 95338580 nonsense probably null
IGL01710:Setdb1 APN 3 95338853 missense probably damaging 1.00
IGL02795:Setdb1 APN 3 95327373 missense probably damaging 1.00
IGL02824:Setdb1 APN 3 95339904 splice site probably benign
IGL02838:Setdb1 APN 3 95337268 splice site probably null
IGL03014:Setdb1 UTSW 3 95341415 missense probably damaging 1.00
R0077:Setdb1 UTSW 3 95341451 missense probably damaging 1.00
R0344:Setdb1 UTSW 3 95326131 unclassified probably benign
R0367:Setdb1 UTSW 3 95349881 splice site probably benign
R0374:Setdb1 UTSW 3 95324853 unclassified probably benign
R0411:Setdb1 UTSW 3 95327686 missense probably damaging 1.00
R0501:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0521:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0616:Setdb1 UTSW 3 95341798 missense probably damaging 1.00
R0828:Setdb1 UTSW 3 95338860 missense probably damaging 1.00
R0990:Setdb1 UTSW 3 95340265 missense probably benign 0.00
R1263:Setdb1 UTSW 3 95327611 missense probably damaging 0.99
R1297:Setdb1 UTSW 3 95349876 splice site probably benign
R1497:Setdb1 UTSW 3 95327467 missense probably benign 0.44
R2885:Setdb1 UTSW 3 95340195 missense probably benign
R2907:Setdb1 UTSW 3 95327201 splice site probably benign
R3236:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3237:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3972:Setdb1 UTSW 3 95341338 missense probably damaging 1.00
R4260:Setdb1 UTSW 3 95327497 missense probably damaging 0.96
R5284:Setdb1 UTSW 3 95327570 missense probably damaging 1.00
R5484:Setdb1 UTSW 3 95337258 missense probably damaging 1.00
R5955:Setdb1 UTSW 3 95338842 missense probably damaging 1.00
R6542:Setdb1 UTSW 3 95340307 missense probably damaging 1.00
R6632:Setdb1 UTSW 3 95324149 missense probably damaging 1.00
R6785:Setdb1 UTSW 3 95326401 missense probably benign 0.09
R7176:Setdb1 UTSW 3 95337147 critical splice donor site probably null
R7250:Setdb1 UTSW 3 95354541 critical splice donor site probably null
R7259:Setdb1 UTSW 3 95339913 missense probably benign 0.08
R7282:Setdb1 UTSW 3 95338674 missense probably damaging 1.00
R7497:Setdb1 UTSW 3 95341828 missense probably damaging 1.00
R7553:Setdb1 UTSW 3 95346765 missense probably damaging 1.00
R7921:Setdb1 UTSW 3 95326399 missense possibly damaging 0.85
R8022:Setdb1 UTSW 3 95338599 missense probably damaging 1.00
R8022:Setdb1 UTSW 3 95347085 missense probably damaging 1.00
R8189:Setdb1 UTSW 3 95346711 missense probably damaging 1.00
Z1177:Setdb1 UTSW 3 95338530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAAACACTTTATGCATCCATCC -3'
(R):5'- TCGGGTCACTACCTACTTGATG -3'

Sequencing Primer
(F):5'- TTAATGTTAGGGAGTGATCCAGCACC -3'
(R):5'- GTCTATCAGTAACTGTGTCATTGAC -3'
Posted On2018-06-22