Incidental Mutation 'R6642:Kctd9'
ID525873
Institutional Source Beutler Lab
Gene Symbol Kctd9
Ensembl Gene ENSMUSG00000034327
Gene Namepotassium channel tetramerisation domain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location67715937-67742310 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 67724673 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 55 (L55*)
Ref Sequence ENSEMBL: ENSMUSP00000115002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078053] [ENSMUST00000125212] [ENSMUST00000145542] [ENSMUST00000150768] [ENSMUST00000152243] [ENSMUST00000156700]
Predicted Effect probably null
Transcript: ENSMUST00000078053
AA Change: L55*
SMART Domains Protein: ENSMUSP00000077200
Gene: ENSMUSG00000034327
AA Change: L55*

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 3.5e-22 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 253 292 1e-14 PFAM
Pfam:Pentapeptide_4 258 334 2.7e-15 PFAM
Pfam:Pentapeptide 288 327 6.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125212
Predicted Effect probably benign
Transcript: ENSMUST00000145542
Predicted Effect probably null
Transcript: ENSMUST00000150768
AA Change: L55*
SMART Domains Protein: ENSMUSP00000114489
Gene: ENSMUSG00000034327
AA Change: L55*

DomainStartEndE-ValueType
Pfam:KHA 2 64 1.4e-21 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 219 255 9.3e-8 PFAM
Pfam:Pentapeptide 248 280 9.3e-11 PFAM
Pfam:Pentapeptide 258 297 3e-10 PFAM
Pfam:Pentapeptide 303 342 3.2e-13 PFAM
Pfam:Pentapeptide_4 308 384 3.3e-13 PFAM
Pfam:Pentapeptide 338 377 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152243
SMART Domains Protein: ENSMUSP00000120440
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:BTB_2 1 70 1.3e-13 PFAM
Pfam:BTB 1 78 6.2e-7 PFAM
Pfam:Pentapeptide 105 137 4.3e-8 PFAM
Pfam:Pentapeptide 134 166 5.5e-11 PFAM
Pfam:Pentapeptide 144 183 1.5e-10 PFAM
Pfam:Pentapeptide_4 165 239 5.3e-9 PFAM
Pfam:Pentapeptide 189 228 1.7e-13 PFAM
Pfam:Pentapeptide 209 237 9.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156700
AA Change: L55*
SMART Domains Protein: ENSMUSP00000115002
Gene: ENSMUSG00000034327
AA Change: L55*

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 2.5e-23 PFAM
SCOP:d3kvt__ 89 107 9e-4 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Kctd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Kctd9 APN 14 67724681 critical splice donor site probably null
IGL03034:Kctd9 APN 14 67734279 missense probably benign 0.36
domain UTSW 14 67724673 nonsense probably null
model UTSW 14 67729692 missense possibly damaging 0.95
motif UTSW 14 67729356 missense probably damaging 1.00
Prototype UTSW 14 67740387 missense probably damaging 1.00
R0686:Kctd9 UTSW 14 67728736 missense probably damaging 1.00
R1069:Kctd9 UTSW 14 67729420 splice site probably benign
R3737:Kctd9 UTSW 14 67734288 missense possibly damaging 0.92
R3738:Kctd9 UTSW 14 67734288 missense possibly damaging 0.92
R4785:Kctd9 UTSW 14 67734164 missense probably damaging 1.00
R4939:Kctd9 UTSW 14 67729686 missense probably damaging 1.00
R4989:Kctd9 UTSW 14 67729356 missense probably damaging 1.00
R5133:Kctd9 UTSW 14 67729356 missense probably damaging 1.00
R5138:Kctd9 UTSW 14 67728748 critical splice donor site probably null
R5232:Kctd9 UTSW 14 67724661 missense probably damaging 1.00
R5454:Kctd9 UTSW 14 67740387 missense probably damaging 1.00
R7128:Kctd9 UTSW 14 67738523 missense probably benign 0.02
R7863:Kctd9 UTSW 14 67729717 missense possibly damaging 0.84
R8068:Kctd9 UTSW 14 67724662 missense unknown
R8166:Kctd9 UTSW 14 67729692 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTGTAACGTCAGTGATTCGTTG -3'
(R):5'- GTGGTAAACCCCTGCTATTATCTC -3'

Sequencing Primer
(F):5'- AACGTCAGTGATTCGTTGTATGTG -3'
(R):5'- AAACCCCTGCTATTATCTCTAGTTAG -3'
Posted On2018-06-22