Incidental Mutation 'R6642:Olfm4'
ID525875
Institutional Source Beutler Lab
Gene Symbol Olfm4
Ensembl Gene ENSMUSG00000022026
Gene Nameolfactomedin 4
SynonymsGW112, OlfD, pPD4, GC1, LOC239192, LOC380924
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location79984081-80023139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80021667 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 419 (K419E)
Ref Sequence ENSEMBL: ENSMUSP00000154285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088735] [ENSMUST00000228749]
Predicted Effect probably damaging
Transcript: ENSMUST00000088735
AA Change: K452E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086112
Gene: ENSMUSG00000022026
AA Change: K452E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 225 243 N/A INTRINSIC
OLF 274 532 8.53e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226541
Predicted Effect probably damaging
Transcript: ENSMUST00000228749
AA Change: K419E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.5733 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was originally cloned from human myeloblasts and found to be selectively expressed in inflammed colonic epithelium. This gene encodes a member of the olfactomedin family. The encoded protein is an antiapoptotic factor that promotes tumor growth and is an extracellular matrix glycoprotein that facilitates cell adhesion. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced colonization of the gastric mucosa by Helicobacter pylori but increased inflammatory response to H. pylori infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Olfm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00532:Olfm4 APN 14 80021143 missense probably benign 0.12
IGL01108:Olfm4 APN 14 80021899 missense probably benign 0.15
IGL01599:Olfm4 APN 14 80021310 missense probably damaging 1.00
IGL01872:Olfm4 APN 14 80021928 makesense probably null
IGL01928:Olfm4 APN 14 80011952 missense possibly damaging 0.71
IGL02333:Olfm4 APN 14 80021770 missense probably damaging 1.00
IGL02336:Olfm4 APN 14 80006321 missense probably damaging 1.00
IGL02811:Olfm4 APN 14 80021673 missense probably damaging 1.00
PIT4651001:Olfm4 UTSW 14 80021485 missense probably benign 0.00
R1428:Olfm4 UTSW 14 80021403 missense probably damaging 1.00
R1649:Olfm4 UTSW 14 80011982 missense probably damaging 0.98
R2139:Olfm4 UTSW 14 80014315 missense probably benign 0.00
R2270:Olfm4 UTSW 14 80011875 missense probably damaging 0.96
R2401:Olfm4 UTSW 14 80021752 missense probably damaging 1.00
R4527:Olfm4 UTSW 14 80021224 missense probably benign 0.13
R4649:Olfm4 UTSW 14 80021307 missense probably benign 0.00
R5232:Olfm4 UTSW 14 80021682 missense probably damaging 1.00
R5512:Olfm4 UTSW 14 80021347 missense probably benign 0.32
R6198:Olfm4 UTSW 14 80000373 missense probably benign 0.18
R6828:Olfm4 UTSW 14 80021533 missense probably damaging 1.00
R6916:Olfm4 UTSW 14 80014198 missense probably damaging 0.97
R6960:Olfm4 UTSW 14 80021314 missense probably damaging 0.97
R7329:Olfm4 UTSW 14 80011929 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTGGCTGCCTACAATAATCGC -3'
(R):5'- CTGGGCGTCTGTAAGAAGAC -3'

Sequencing Primer
(F):5'- GCCTACAATAATCGCTTCTCATATG -3'
(R):5'- TCAAAGGGATGGTAATTGATGCTC -3'
Posted On2018-06-22