Incidental Mutation 'R6642:Ywhaz'
ID525877
Institutional Source Beutler Lab
Gene Symbol Ywhaz
Ensembl Gene ENSMUSG00000022285
Gene Nametyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide
Synonyms1110013I11Rik, 14-3-3 zeta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36770770-36796929 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36790922 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 19 (Y19C)
Ref Sequence ENSEMBL: ENSMUSP00000120610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022894] [ENSMUST00000110359] [ENSMUST00000110361] [ENSMUST00000110362] [ENSMUST00000126184] [ENSMUST00000151635] [ENSMUST00000226851]
Predicted Effect probably damaging
Transcript: ENSMUST00000022894
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022894
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110359
AA Change: Y19C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000110361
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105990
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110362
AA Change: Y19C

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105991
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 242 1.25e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126184
AA Change: Y19C

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115928
Gene: ENSMUSG00000022285
AA Change: Y19C

DomainStartEndE-ValueType
14_3_3 3 88 2.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151635
AA Change: Y19C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154879
Predicted Effect probably damaging
Transcript: ENSMUST00000226851
AA Change: Y19C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227067
Meta Mutation Damage Score 0.9353 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the 14-3-3 family of proteins which mediate signal transduction by binding to phosphoserine-containing proteins. This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat and sheep orthologs. The encoded protein interacts with IRS1 protein, suggesting a role in regulating insulin sensitivity. Several transcript variants that differ in the 5' UTR but that encode the same protein have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation after P14, some postnatal lethality by P21. Mice homozygous for one gene trap allele also exhibit neurodevelopmental and neuropsychiatric behaviour defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Other mutations in Ywhaz
AlleleSourceChrCoordTypePredicted EffectPPH Score
Impecunious UTSW 15 36790922 missense probably damaging 1.00
R0559:Ywhaz UTSW 15 36790964 missense possibly damaging 0.80
R1291:Ywhaz UTSW 15 36772734 unclassified probably benign
R1705:Ywhaz UTSW 15 36790715 missense possibly damaging 0.55
R5810:Ywhaz UTSW 15 36775266 missense probably damaging 1.00
R6579:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6582:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6583:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
R6643:Ywhaz UTSW 15 36790922 missense probably damaging 1.00
X0027:Ywhaz UTSW 15 36775556 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTGCAGATGTCACGCAGCTC -3'
(R):5'- GCCTTTTAATTGCTCAAGCTGG -3'

Sequencing Primer
(F):5'- ACGCAGCTCCGTCTCGATC -3'
(R):5'- CTCAAGCTGGTTTGAGGTACTG -3'
Posted On2018-06-22