Incidental Mutation 'R6642:Sgsm3'
ID525879
Institutional Source Beutler Lab
Gene Symbol Sgsm3
Ensembl Gene ENSMUSG00000042303
Gene Namesmall G protein signaling modulator 3
SynonymsCIP85, Rutbc3, 1810012I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6642 (G1)
Quality Score184.009
Status Validated
Chromosome15
Chromosomal Location80977765-81012290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81009700 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 479 (R479C)
Ref Sequence ENSEMBL: ENSMUSP00000122543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109579] [ENSMUST00000131235] [ENSMUST00000134469] [ENSMUST00000137255] [ENSMUST00000139517] [ENSMUST00000143147] [ENSMUST00000149582] [ENSMUST00000228971] [ENSMUST00000229727]
PDB Structure
Solution structure of the SH3 domain of mouse RUN and TBC1 domain containing 3 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000109579
SMART Domains Protein: ENSMUSP00000105207
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 15 40 2.17e-7 SMART
RPEL 59 84 1.36e-8 SMART
RPEL 103 128 1.03e-8 SMART
low complexity region 146 159 N/A INTRINSIC
low complexity region 209 228 N/A INTRINSIC
low complexity region 259 272 N/A INTRINSIC
low complexity region 298 320 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
SAP 385 419 4.98e-10 SMART
low complexity region 424 433 N/A INTRINSIC
low complexity region 483 496 N/A INTRINSIC
coiled coil region 558 600 N/A INTRINSIC
low complexity region 670 679 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124845
AA Change: R406C
Predicted Effect probably benign
Transcript: ENSMUST00000131235
SMART Domains Protein: ENSMUSP00000120116
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 187 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 280 N/A INTRINSIC
SAP 300 334 4.98e-10 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 398 411 N/A INTRINSIC
coiled coil region 473 515 N/A INTRINSIC
low complexity region 585 594 N/A INTRINSIC
low complexity region 629 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132039
Predicted Effect probably benign
Transcript: ENSMUST00000134469
SMART Domains Protein: ENSMUSP00000119530
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134559
Predicted Effect probably benign
Transcript: ENSMUST00000137255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138550
Predicted Effect probably damaging
Transcript: ENSMUST00000139517
AA Change: R479C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122543
Gene: ENSMUSG00000042303
AA Change: R479C

DomainStartEndE-ValueType
TBC 111 328 3.6e-62 SMART
low complexity region 381 391 N/A INTRINSIC
SH3 483 538 6.34e-19 SMART
RUN 654 716 1.29e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149345
Predicted Effect unknown
Transcript: ENSMUST00000154904
AA Change: R109C
SMART Domains Protein: ENSMUSP00000118050
Gene: ENSMUSG00000042303
AA Change: R109C

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
SH3 114 169 6.34e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156783
Predicted Effect probably benign
Transcript: ENSMUST00000149582
SMART Domains Protein: ENSMUSP00000117745
Gene: ENSMUSG00000042292

DomainStartEndE-ValueType
RPEL 24 49 1.36e-8 SMART
RPEL 68 93 1.03e-8 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 263 285 N/A INTRINSIC
low complexity region 305 330 N/A INTRINSIC
SAP 350 384 4.98e-10 SMART
low complexity region 389 398 N/A INTRINSIC
low complexity region 448 461 N/A INTRINSIC
coiled coil region 523 565 N/A INTRINSIC
low complexity region 635 644 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230118
Predicted Effect probably benign
Transcript: ENSMUST00000228971
Predicted Effect probably benign
Transcript: ENSMUST00000229727
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Sgsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Sgsm3 APN 15 81010852 unclassified probably benign
IGL03370:Sgsm3 APN 15 81011654 critical splice acceptor site probably null
R0109:Sgsm3 UTSW 15 81009466 missense probably damaging 0.99
R0267:Sgsm3 UTSW 15 81006602 missense probably damaging 0.96
R0382:Sgsm3 UTSW 15 81008314 nonsense probably null
R0441:Sgsm3 UTSW 15 81009770 missense possibly damaging 0.87
R0631:Sgsm3 UTSW 15 81011736 makesense probably null
R0905:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R1364:Sgsm3 UTSW 15 81007942 missense probably damaging 0.98
R1515:Sgsm3 UTSW 15 81010256 missense probably benign 0.08
R2226:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2227:Sgsm3 UTSW 15 81003868 missense probably damaging 0.96
R2414:Sgsm3 UTSW 15 81006745 missense probably benign 0.10
R2508:Sgsm3 UTSW 15 81003872 critical splice donor site probably null
R4240:Sgsm3 UTSW 15 81011782 unclassified probably benign
R4302:Sgsm3 UTSW 15 81010301 unclassified probably benign
R4899:Sgsm3 UTSW 15 81006779 missense probably benign 0.13
R5234:Sgsm3 UTSW 15 81007944 missense probably damaging 1.00
R5288:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5385:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5386:Sgsm3 UTSW 15 81007999 missense probably benign 0.00
R5682:Sgsm3 UTSW 15 81011460 critical splice acceptor site probably null
R6052:Sgsm3 UTSW 15 81009263 missense probably benign
R6349:Sgsm3 UTSW 15 81008346 missense probably benign 0.00
R6453:Sgsm3 UTSW 15 81011314 missense probably damaging 0.96
R6486:Sgsm3 UTSW 15 81011345 missense probably damaging 1.00
R6591:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6691:Sgsm3 UTSW 15 81008862 missense possibly damaging 0.94
R6897:Sgsm3 UTSW 15 81008894 missense probably benign 0.00
R7038:Sgsm3 UTSW 15 81008375 missense possibly damaging 0.86
R7390:Sgsm3 UTSW 15 81008820 missense possibly damaging 0.77
R7572:Sgsm3 UTSW 15 81007466 missense possibly damaging 0.78
R7730:Sgsm3 UTSW 15 81008726 missense probably damaging 1.00
R7851:Sgsm3 UTSW 15 81010753 missense probably damaging 1.00
R8186:Sgsm3 UTSW 15 81009442 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGAAGCCATTTTGCGTGTGG -3'
(R):5'- CCGGGCTGAGATCAAGCTTATTC -3'

Sequencing Primer
(F):5'- CCCCAAGAACTGTAGTGTGG -3'
(R):5'- GCTTATTCAACATCAGCTCTACAGGG -3'
Posted On2018-06-22