Incidental Mutation 'R6610:Stk32b'
List |< first << previous [record 37 of 47] next >> last >|
ID525882
Institutional Source Beutler Lab
Gene Symbol Stk32b
Ensembl Gene ENSMUSG00000029123
Gene Nameserine/threonine kinase 32B
SynonymsYANK2, 2510009F08Rik, Stk32, STKG6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6610 (G1)
Quality Score222.009
Status Validated
Chromosome5
Chromosomal Location37446825-37717171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37448678 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 407 (T407I)
Ref Sequence ENSEMBL: ENSMUSP00000092432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094836]
Predicted Effect probably benign
Transcript: ENSMUST00000094836
AA Change: T407I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000092432
Gene: ENSMUSG00000029123
AA Change: T407I

DomainStartEndE-ValueType
S_TKc 23 283 1.18e-84 SMART
low complexity region 323 336 N/A INTRINSIC
Meta Mutation Damage Score 0.0683 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine protein kinase. Serine-threonine kinases transfer phosphate molecules to the oxygen atoms of serine and threonine. A genomic deletion affecting this gene has been associated with Ellis-van Creveld syndrome, an autosomal recessive skeletal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AB124611 A T 9: 21,526,265 M1L probably benign Het
Adam26b T C 8: 43,521,153 K271E probably damaging Het
Ankrd44 A G 1: 54,655,087 I914T probably benign Het
Atp12a A G 14: 56,374,556 R396G probably damaging Het
C2cd3 A G 7: 100,455,298 K2173E probably benign Het
Cbx2 A G 11: 119,024,210 D51G probably damaging Het
Ccdc33 T A 9: 58,069,136 T532S possibly damaging Het
Ccnt1 T C 15: 98,565,101 I63M probably damaging Het
Cdc20b C T 13: 113,064,262 T172I probably benign Het
Ces2f T G 8: 104,950,106 probably null Het
Cfh A T 1: 140,101,748 C597* probably null Het
Cntnap2 A T 6: 46,015,257 T373S probably benign Het
Cyb5r4 T G 9: 87,059,417 C64G probably benign Het
Cyp2c23 A G 19: 44,007,081 F416L probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Eif4e1b A G 13: 54,784,315 probably benign Het
Etl4 G A 2: 20,713,369 R256K probably damaging Het
Fhad1 A G 4: 141,916,396 L1054P possibly damaging Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Grik1 A G 16: 88,034,312 I190T probably damaging Het
Gsdmc2 T C 15: 63,825,008 N438S probably benign Het
Igkv15-103 A T 6: 68,437,633 R19* probably null Het
Ikbkap A G 4: 56,758,236 V1227A probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Lhcgr A T 17: 88,769,879 I93K possibly damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Mymk G T 2: 27,067,393 S29R possibly damaging Het
Nab2 A T 10: 127,664,338 I295N probably damaging Het
Neu2 A T 1: 87,596,685 T131S probably benign Het
Pdcd7 T A 9: 65,354,683 M129K possibly damaging Het
Ptar1 A G 19: 23,717,844 H225R probably benign Het
Pygb T A 2: 150,823,966 probably null Het
Rpap3 T C 15: 97,688,168 D314G probably benign Het
Scara3 A G 14: 65,931,221 S316P probably damaging Het
Sec24a C T 11: 51,696,656 V1051I probably benign Het
Setdb1 G T 3: 95,328,577 A841D probably damaging Het
Tcte2 G A 17: 13,727,988 Q10* probably null Het
Tgm2 C A 2: 158,143,100 E29* probably null Het
Trim32 G A 4: 65,615,071 V622M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Vmn1r123 A G 7: 21,162,590 N136D probably benign Het
Vmn2r31 A T 7: 7,384,589 V661E probably damaging Het
Vmn2r85 A T 10: 130,425,969 F166L probably damaging Het
Zfp426 T C 9: 20,473,093 K98R probably damaging Het
Zfp534 C T 4: 147,674,490 R574K probably benign Het
Other mutations in Stk32b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Stk32b APN 5 37499030 splice site probably benign
IGL02525:Stk32b APN 5 37531633 missense probably damaging 1.00
IGL02946:Stk32b APN 5 37531539 splice site probably benign
IGL03277:Stk32b APN 5 37628976 missense probably damaging 0.99
H8441:Stk32b UTSW 5 37457234 missense probably damaging 1.00
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0042:Stk32b UTSW 5 37716748 missense probably benign 0.09
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0051:Stk32b UTSW 5 37459596 splice site probably benign
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0062:Stk32b UTSW 5 37461448 missense probably damaging 1.00
R0601:Stk32b UTSW 5 37531566 missense probably damaging 1.00
R0879:Stk32b UTSW 5 37459596 splice site probably benign
R1812:Stk32b UTSW 5 37466758 missense probably damaging 1.00
R1882:Stk32b UTSW 5 37531687 missense possibly damaging 0.91
R1982:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R3899:Stk32b UTSW 5 37457154 missense probably damaging 1.00
R4724:Stk32b UTSW 5 37454934 critical splice donor site probably null
R4885:Stk32b UTSW 5 37466797 missense probably damaging 1.00
R5531:Stk32b UTSW 5 37459734 splice site probably null
R5629:Stk32b UTSW 5 37457232 missense probably damaging 1.00
R6042:Stk32b UTSW 5 37649114 missense probably damaging 0.99
R6864:Stk32b UTSW 5 37448805 splice site probably null
R6879:Stk32b UTSW 5 37490523 missense possibly damaging 0.77
R7186:Stk32b UTSW 5 37466781 missense probably damaging 1.00
R8317:Stk32b UTSW 5 37454975 missense probably damaging 0.99
V1024:Stk32b UTSW 5 37457234 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTACATATCTGCAGTCCAACC -3'
(R):5'- ACCATCATGTAGCTGCATCC -3'

Sequencing Primer
(F):5'- GTGATTTGCTCAAGGTCACACAGC -3'
(R):5'- TGCATCCAGCCCACCAC -3'
Posted On2018-06-22