Incidental Mutation 'R6642:Vmn2r110'
ID525884
Institutional Source Beutler Lab
Gene Symbol Vmn2r110
Ensembl Gene ENSMUSG00000091259
Gene Namevomeronasal 2, receptor 110
SynonymsEG224582
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20573829-20596259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20583517 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 265 (N265K)
Ref Sequence ENSEMBL: ENSMUSP00000129347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169559
AA Change: N265K

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259
AA Change: N265K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn1r233 A T 17: 20,993,740 L316Q probably damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Vmn2r110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Vmn2r110 APN 17 20583627 missense probably benign 0.01
IGL01824:Vmn2r110 APN 17 20574667 missense probably benign 0.44
IGL01879:Vmn2r110 APN 17 20573860 missense probably benign 0.01
IGL02168:Vmn2r110 APN 17 20583800 splice site probably benign
IGL02178:Vmn2r110 APN 17 20584444 splice site probably null
IGL02322:Vmn2r110 APN 17 20573935 missense probably damaging 1.00
IGL02323:Vmn2r110 APN 17 20596137 missense probably damaging 0.98
IGL02415:Vmn2r110 APN 17 20583771 missense probably benign 0.03
IGL02491:Vmn2r110 APN 17 20596138 missense probably damaging 0.99
IGL02876:Vmn2r110 APN 17 20574296 missense probably damaging 0.98
IGL03141:Vmn2r110 APN 17 20583714 missense possibly damaging 0.79
IGL03270:Vmn2r110 APN 17 20583516 missense probably benign 0.00
IGL03286:Vmn2r110 APN 17 20584206 missense possibly damaging 0.95
IGL03379:Vmn2r110 APN 17 20583644 missense probably damaging 0.99
PIT4243001:Vmn2r110 UTSW 17 20582117 missense probably benign 0.01
R0040:Vmn2r110 UTSW 17 20596084 missense probably benign 0.10
R0195:Vmn2r110 UTSW 17 20574055 missense probably benign 0.31
R0716:Vmn2r110 UTSW 17 20573903 missense probably damaging 0.99
R1199:Vmn2r110 UTSW 17 20583263 missense probably benign 0.03
R1767:Vmn2r110 UTSW 17 20580578 missense possibly damaging 0.83
R2212:Vmn2r110 UTSW 17 20573947 splice site probably null
R3056:Vmn2r110 UTSW 17 20583098 missense probably damaging 1.00
R4093:Vmn2r110 UTSW 17 20583380 missense possibly damaging 0.83
R4418:Vmn2r110 UTSW 17 20583689 nonsense probably null
R4598:Vmn2r110 UTSW 17 20583767 nonsense probably null
R4754:Vmn2r110 UTSW 17 20596196 missense probably benign 0.00
R5283:Vmn2r110 UTSW 17 20580637 missense probably benign 0.00
R5421:Vmn2r110 UTSW 17 20583620 missense probably damaging 1.00
R5672:Vmn2r110 UTSW 17 20596232 missense probably benign
R5865:Vmn2r110 UTSW 17 20584295 missense probably benign 0.00
R6799:Vmn2r110 UTSW 17 20583536 missense probably benign
R7167:Vmn2r110 UTSW 17 20574179 missense probably benign 0.01
R7291:Vmn2r110 UTSW 17 20574209 missense probably benign 0.13
R7320:Vmn2r110 UTSW 17 20596054 missense probably benign
R7519:Vmn2r110 UTSW 17 20584262 missense probably benign
R8089:Vmn2r110 UTSW 17 20583545 missense probably benign 0.00
R8234:Vmn2r110 UTSW 17 20584429 missense probably benign 0.12
R8272:Vmn2r110 UTSW 17 20596228 missense probably damaging 0.97
R8307:Vmn2r110 UTSW 17 20583057 missense probably benign 0.00
R8506:Vmn2r110 UTSW 17 20584365 missense probably benign 0.00
R8516:Vmn2r110 UTSW 17 20574613 missense probably damaging 1.00
Z1088:Vmn2r110 UTSW 17 20583680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACCATGGAAAGAGTCAAAC -3'
(R):5'- CCATTTTGAGTGACCGTGGTC -3'

Sequencing Primer
(F):5'- AACATGAAATAGTCAGCATAGTCAG -3'
(R):5'- CCAAGTACTCATCAATTTCACGTGG -3'
Posted On2018-06-22