Incidental Mutation 'R6642:Vmn1r233'
ID525885
Institutional Source Beutler Lab
Gene Symbol Vmn1r233
Ensembl Gene ENSMUSG00000045575
Gene Namevomeronasal 1 receptor 233
SynonymsV1rf5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6642 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20993727-20994686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20993740 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 316 (L316Q)
Ref Sequence ENSEMBL: ENSMUSP00000062473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056339]
Predicted Effect probably damaging
Transcript: ENSMUST00000056339
AA Change: L316Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062473
Gene: ENSMUSG00000045575
AA Change: L316Q

DomainStartEndE-ValueType
Pfam:TAS2R 8 304 4.8e-11 PFAM
Pfam:7tm_1 11 297 7.9e-7 PFAM
Pfam:V1R 40 303 1.3e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T A 2: 152,440,870 V215D probably damaging Het
Ablim1 A G 19: 57,130,852 S267P probably benign Het
Adcy2 C T 13: 68,620,826 C1061Y probably damaging Het
Aip C A 19: 4,115,149 C240F probably damaging Het
Aldh1a2 A T 9: 71,252,986 D98V probably damaging Het
Arhgef40 T C 14: 51,990,962 probably benign Het
Cplx2 G T 13: 54,378,923 R48L probably damaging Het
Ctrl C T 8: 105,932,819 probably null Het
Dnhd1 A G 7: 105,703,799 T2720A probably benign Het
Fzd1 A G 5: 4,755,696 Y629H probably damaging Het
Gins1 T C 2: 150,928,118 probably null Het
Gpr149 C T 3: 62,530,574 A721T probably damaging Het
Helb A T 10: 120,084,930 M1036K probably benign Het
Il16 A G 7: 83,688,127 F127L probably benign Het
Kctd20 A T 17: 28,961,666 H138L probably damaging Het
Kctd9 T A 14: 67,724,673 L55* probably null Het
Marf1 C T 16: 14,132,747 R925H probably benign Het
Mbip A T 12: 56,342,406 probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Nod1 T G 6: 54,948,029 D99A probably damaging Het
Olfm4 A G 14: 80,021,667 K419E probably damaging Het
Olfr807 A T 10: 129,755,363 L29Q probably damaging Het
Pik3r4 A G 9: 105,644,646 D137G probably benign Het
Prdm4 T C 10: 85,907,818 E191G probably benign Het
Rassf10 A T 7: 112,955,577 T462S probably benign Het
Rundc3b A T 5: 8,579,071 I110N probably damaging Het
Sgsm3 C T 15: 81,009,700 R479C probably damaging Het
Tmc7 A T 7: 118,545,611 Y575* probably null Het
Trim33 T C 3: 103,337,514 L310S probably damaging Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Ttn T C 2: 76,735,396 E28204G probably damaging Het
Vmn2r110 A T 17: 20,583,517 N265K possibly damaging Het
Xylb A G 9: 119,367,493 H114R probably damaging Het
Ywhaz T C 15: 36,790,922 Y19C probably damaging Het
Other mutations in Vmn1r233
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Vmn1r233 APN 17 20994599 missense probably damaging 1.00
IGL01912:Vmn1r233 APN 17 20994205 missense probably benign 0.02
IGL02642:Vmn1r233 APN 17 20994029 missense probably damaging 0.97
IGL02730:Vmn1r233 APN 17 20993795 missense possibly damaging 0.81
IGL02754:Vmn1r233 APN 17 20994625 missense probably benign 0.37
IGL02754:Vmn1r233 APN 17 20994624 missense probably benign
BB008:Vmn1r233 UTSW 17 20993863 missense probably benign
BB018:Vmn1r233 UTSW 17 20993863 missense probably benign
R0368:Vmn1r233 UTSW 17 20994607 missense possibly damaging 0.93
R1894:Vmn1r233 UTSW 17 20993732 missense probably benign 0.02
R2507:Vmn1r233 UTSW 17 20993848 missense probably benign 0.29
R4609:Vmn1r233 UTSW 17 20994415 missense possibly damaging 0.79
R4662:Vmn1r233 UTSW 17 20994131 missense probably benign 0.16
R4686:Vmn1r233 UTSW 17 20994106 missense probably benign 0.33
R4721:Vmn1r233 UTSW 17 20994617 missense probably benign
R5559:Vmn1r233 UTSW 17 20994577 missense possibly damaging 0.74
R5651:Vmn1r233 UTSW 17 20994017 missense probably benign 0.00
R7285:Vmn1r233 UTSW 17 20993959 missense probably damaging 1.00
R7931:Vmn1r233 UTSW 17 20993863 missense probably benign
R7936:Vmn1r233 UTSW 17 20993975 nonsense probably null
R7984:Vmn1r233 UTSW 17 20994155 missense probably damaging 0.99
R8059:Vmn1r233 UTSW 17 20994436 missense probably benign 0.06
Z1176:Vmn1r233 UTSW 17 20994658 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTAGCTTGTGTACAAAATGACACAC -3'
(R):5'- AATGCCCAGGATGAATGTTTCTTC -3'

Sequencing Primer
(F):5'- CTCCACAGTCACTTGTCA -3'
(R):5'- GATGAATGTTTCTTCCAAATCCACC -3'
Posted On2018-06-22